Detailed Information [103554]

Strain Information
DGRC Number 103554
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}CG33090[NP0189] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype w*; P{w+mW.hs=GawB}CG33090NP0189 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 35A4
Map Viewer
Related Genes BG:DS01068.11 BG:DS01068.1 BG:DS01068.2
Original Number 189
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0189
NP line. Received from the National Institute of Genetics.
Balancer CyUW14
Cluster id 1187
General Information NP_lines
Embryonic Expression muscle subset
Larval GFP cns
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np04275_0711
Flanking Sequence
gtcaacgtgcactgcanttaagtgtatacttcggtaagcttcggctatcgacgggcacca
ccttatgttatttcatcatgGTTCCGCCATTTCGAGGTTTCGTTTTCGATgatcgaagaa
tacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagg
gcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgg
gcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacag
tcaactgtctttgacctttgttactactctcttccgatgatgatgtcgcacttattctat
gctgtctcaatgttagaggcatatcagtctccactgaagccatctttattttgggnnnnn
nnnntnnnnnnnnnnnnnnnnnnnnnnnntnnntnnnnnntnnnnnnnnnnnnncnnnnn
nnnnnntnnntnnnannncnnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnn

Library Name / Clone Name np / np54593_0309
Strand Plus
Insertion Point 14316465
Chromosome Band 2L
Flanking Sequence
actnttcagtgcgcacttatngcaagtnatacgttaagtggatgtctcttgccgacgggn
accaccttatgttatttcatcatgGGCGGAACCTTTAGCAGTGGAAACCAAGCCGCTGAG
CAACGGAAATGCCAATGGAAACGCAGTGGGAATCGCCGAATCCGCCAGCGTCGTCTTCCA
GGAGAAGTTGAAGCTCCAGCAGCAGGAGGAGTCCAACGAGATCNTCTAGCTANNGCNTTG
CGGACTTCGTNNATTATTAAAACTANAACTTNAANAANAATNACGATCNAATTAATNNTA
TGAGGGNATTCAAACCNCNCGGNCATGCTAATGNGGANTAAACAATAATNATATNGNTGT
CTNNCTNATANTNAAAACNCCNCTNAAATNANTNTNNNTNATTATCCCNNTTATTGNNNN
NNNANNANNANNNNNTNTNNNTNNNNNNNNNNACNNNNNNNNNNNNNTNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnn


CLOSE