Detailed Information [103560]
 

Strain Information
DGRC Number 103560
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Tm1[NP0223] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype w*; P{w+mW.hs=GawB}Tm1NP0223 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 88E12
Map Viewer
Related Genes Tm2 Tm1
Original Number 223
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP0223
NP line. Received from the National Institute of Genetics.
Balancer TM6UW23-1
Cluster id 1496
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression cns, pns subset?
Larval GFP pns
Larval X-gal sg, dots on gut
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np10025_0727
Strand Plus
Insertion Point 11117840
Chromosome Band 3R
Flanking Sequence
tgcattnantgtatcttcggtaagcttcggctatcgacgggaccaccttatgttatttca
tcatgGGTTGGCCTTCTAGCTTTCTGCTTTCTCAGCGACAAAAAAAGAACAGAAAAACAA
AAACCGGCTTTAAGTCCGGCAAAGAAGCCACATCGTTTAGCTAGCGGTGTTCTAAATTCG
ATTAATTATGATTTTTACGCCACGGCCATCAATAAGTGGTTTAATTCTCCTAATGCCTTT
CCAGCTTTTTTGCCCGATGGCTCTGCCTTGTTCCTAATTCAATTCTAATTAGACAATTGA
GTGCGCGGGCTCCTTTAAGCGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTNT
ANNCATGCGCACATANGACNNTTTNGGGGGGGGGATNTTTTTTNAGAANAACAGNNNANN
CTNNNATNGCGCCCCNNTNNNTTTTTTNGNGGGGGNGAGAGTGGAAAAAAAAANNTTTTT
TTTTNCNCNNNGNNNNCCCCCNNGNNCAANTNTTTTNTTTTTTTTCCCNNCCNNNNNNNN
NNNTTNNAANNNNGGANAANTTNNAGNGNGNNNNNNNNCNCCNNNNNNNNTTTTNNCCCC
NCCNNCNNNNNGNNNNNNNNNNNNCNCNCCCCNNTNNNNNNGGGGGGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNTTTNNNNNNNNNTNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNN
NNNTTTNNNNNCNCNTNTTNNNNNNNNNNNNNCNNNTTNTNNNNCNNNNNNNNNNGGNNN
NNNNTNNNNNNNNNNCCCNNnnnnaaannnnnnnnnnnnnnnnnnnntnnnnnnnnncnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnncccnnnntntnnnnn
nnnnnnnnnnnnnnaaannnnntnnnnnaaaaantn

CLOSE