Detailed Information [103575]

Strain Information
DGRC Number 103575
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}DNApol-alpha180[NP0280] / TM6C, Sb[1]
Genotype w*; P{w+mW.hs=GawB}DNApol-α180NP0280 / TM6C, Sb1
Break points/Insertion Site 93E10
Map Viewer
Related Genes CG15497 CG31176 DNApol-alpha180
Original Number 280
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP0280
NP line. Received from the National Institute of Genetics.
Balancer TM6UW23-1
Cluster id 1581
General Information NP_lines
Embryonic Expression sg, oenocyte
Larval GFP sg
Larval X-gal sg, epi
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np05425_0711
Strand Minus
Insertion Point 17488410
Chromosome Band 3R
Flanking Sequence
ttgtntcttcggtaagcttcggcttcgacgggaccaccttatgttatttcatcatgCTCC
AGCCCTGGTCACAAAACAATTTTTGCAAACTGCAGCACAACACGGGGAAATTATTATCAA
AGTTAGCCAGTTGCAATGTCTGAATCACCGTGTAAGTTAATAAGATAACTCCCTTAAACA
TATTTTTTACCGAAATTATAAATTTCCAGCTGAACCGCGCGCTAAGCGCCAGAGAGTAGA
CAAAAATGGTAGGTTCGCCGCCATGGAGCGACTGCGTCAGCTGAAGGGAACCAAGAACAA
ATGCAAAGTGGAGGACCAGGTGGACGATGTATACGATGTGGTTGATGAGCGGGAGTACGC
GAAGAGGGCGCAGGAAAAGTACGGNGACGATTGGATCGAAGAATACATAAGAGAGAACCG
NCGCCAAAGAACCCATTATTGGTGGGGTCCCGTTTTCAGGGAGGGCAAGCCATNCGACAT
GTCATTCTNTTNAGACCAATCAAATTCATGAAGAGCATTCCTGGGCATTAAATCCACGGG
ATTGNGGAGGTATCATGATGAGCTGCCGGTCAATCGATACAGCAACTGGCTTTGACCTTG
GTACTACTTTCTTCCGAGATGATGGCCGACCTTTTCTATGCTGNCTCAATGGTAGAGGCA
TATCAGTCTTCACTGAGCTNNTTTTTTTTGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnn


CLOSE