Detailed Information [103583]
 

Strain Information
DGRC Number 103583
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}mod[NP0302] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype w*; P{w+mW.hs=GawB}modNP0302 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 100D1
Map Viewer
Related Genes krz mod
Original Number 302
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP0302
NP line. Received from the National Institute of Genetics.
Balancer TM6UW23-1
Cluster id 1713
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression a small # of cells
Larval X-gal sg, tr (all)
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Lin TY, Luo J, Shinomiya K, Ting CY, Lu Z, Meinertzhagen IA, Lee CH.
Mapping chromatic pathways in the Drosophila visual system.
J. Comp. Neurol. (2016) 524(2) 213-27 [PubMed ID = 26179639] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np41905_0907
Strand Plus
Insertion Point 27867744
Chromosome Band 3R
Flanking Sequence
ggngcnccgcccggggnnngnnggnnngttttttgnnngatttcnggggncannancttn
ttgtgtacttcggtaagcttcggctatcgacgggaccaccttatgttatttcatcatgTA
TTGAACGAAACCACGCGTTGTTCAGTCCAAACTTGACTTTGCTAATTTTGCCCAGAAAAC
CTCTAAAAGCTGTCAAAATGGCCCAAAAGAAAGCCGTCACCGTCAAAGGAAAAAAAGCTA
CGAATGGAGAGGAAAAGCCTTTGGCCAAACGGGTAACCAAGTCCACAAAGGTACAGGAAG
AGGAGACAGTAGTCCCCCAATCGCCTTCCAAAAAATCCAGAAAACAGCCTGTTAAAGAAG
TGCCGCAGTTCAGTGAAGAGGACGAGTCTGATGTGGAGGAGCAAAATGACGAGCAGGCAG
GGGACGACAGCGACTTTGAGGGAAGCTATAAAAAAAACGTGGTCTTCTGAATGGGTATGG
CTAACATTACATGCATAGTATGCACGTATATATAGATCGGAGAATNCATNAGAGAGAACC
CGCGCCAAAGNACCCATTTTTGGTGGGGGNCCGTTTTANGGAAGGCAAGCCCTNCGAAAT
GTCATTCTTTTTAGACCCANCAAATNCATGGAGGGCATTCCCTGGGCATTAAATNCCACN
GNATTGGGGNGNTATCATGAAGAGCTGNCCGAGTNAATCCGATACAGNCCAACTGGNTTT
GGACCTTGGGNACCACCTCTCTTCCGATGAAGAAGGNCNNACTTATTTCTATGCTGGCCT
CAANGGTAGAGGCATATNAGnctccactgagcnnnnnntnnnnnggggnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnccnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)

CLOSE