Detailed Information [103606]

Strain Information
DGRC Number 103606
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}CG6568[NP0396] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype w*; P{w+mW.hs=GawB}CG6568NP0396 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 54B7
Map Viewer
Related Genes Sip1 CG30101 CG6568
Original Number 396
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0396

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 821
General Information NP_lines
Embryonic Expression a small # of cells
Larval GFP fb
Larval X-gal sg, epi, fb
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np06125_0711
Strand Minus
Insertion Point 12470991
Chromosome Band 2R
Flanking Sequence
GTTNTTTTNNACNCAACATNNTNTNNNGGGNAATAAACCCCTNTTTGGGGACNNCGGAAA
AGACCCCGGCTATCGACGGGNACCACCTTTTGTTATTTCATNCATGGNACCAGGCTGTTT
TGTGAAATACGTGATACGTACGGGCTGAGCACAATTTGTTTAAAATTTAAATCATGATAA
AGTAGGTAATTATATTTACTTATTTGCACAGAAACCGTTTTCAAAATCGGAGCCGGGAAA
TGCAANTGTGAGAGTTAATGCAGGTGGTATAGTTNTTAACAAAATACCAGCGATTATAAG
GCCAAGTATGAAGAGAGCAGCAACAACAAAGATGACTGGAGCCACGGCTGCGGGAGCAAC
AACAACAACATCGTCAACAGGTGCAGTGGGATGTGAGTAACAACCAATCGAACACTAATA
TGAAATATAAACAAATGGTTTTTAAATATTGTTCTTATACTTTAGATCGAAGAATACATA
AGAGAGAACCGTCGCCAAAGAACCCATTATTGNNGGGGTCCGNTTTCAGGAAGGGCAAGC
CATNCGACATGTCATCCTCTTCAGACCAATCAAATCCATGAAGAGCATNCCTGGGCATAA
AATCCAACGGAATTGNGGAGTTATCATGATGAGCTGNCGAGNCAATCGATACAGTCAACT
GTCTTTGACCCTTTGGTACTACTCTCTTCCGATGATGATGNCCGCACCTTATTCTATGCT
GGCTCAATGNTAGAGGCATATCAGNCTCCACTGAAGCCATTTTTNTTTGGGNNGGGAGNG
GNNGNAGGNGGGNNGNGGNNngnggngngtnnnnnnnnnnnncnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnntnnnnnnnnnnnnnnnnncnnnnntnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnannnn

Image Files
Disc

d1 (->Large)


CLOSE