Detailed Information [103609]
 

Strain Information
DGRC Number 103609
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP0406 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP0406 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 93F14
Map Viewer
Related Genes how pit
Original Number 406
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP0406

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1587
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression pns subset
Larval GFP epi
Larval X-gal sg, epi
Adult GFP abdomen
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np08415_0711
Flanking Sequence
ACANCTTGTNGGGNAAANAACCCCCTTTTTGGGGCGNNCGGAAAGACCCCGGCTATCGAC
GGGACCACCTTNTGTNATTTAATCATGGCCCAGNCCAAGTCCCTNCAAAACGGAGGCGAC
GATCGNNGAATACATAAGAGAGAACCGGNGCCAAAGAACCCATTATTGATGGGGTCCGTN
TGAAGGAAGGGCAAGCCATCCGACATGCCATCCTCTTNAGNNNTTTTTTTTNCATGAAGA
GCATCCCTGGGCATAAAATCCAACGGAATNGTGGAGATATCATGATGAGCNGCCGAGCNA
ATCGATACAGTCAACTGACTTTGACCTTNGTTACTACTCTCTTCCGATGATGATGNCGCA
CTTATTCTATGCTGTCTCAATGNNAGAGGCATATCAGTCTCCACTGAAGCCAATCTANTC
TGGGAAAGCCATGAAGGAGCATTNCNTTGGGCNTAAAATCCAACGGNAATNGTNGGNGTT
NNTNANNGATGAGGCTGCCCGGNTCANTCNNATACAGNCAACTNGNGGNNGGCCCTTTTG
GNTACTACTCTNTTCCGNGGANGAAGGCCCGCNCCTTATTCCTNTTGCTGNCCTCANNNG
NCGAGAGGGCCGTNTCAANNCCTNNNACTGNAAAGCCCAATNTTANNTTTGGGGNNNNTN
TTTNTCNCCNCCCCCTNCGNTNTTTCNCCTTCTGCNNCGCCCCNCCCCCGNNTGTTNGNC
CCCCCCNGNNCGNNNNCNCCTCNCGCCNTNNNNTNCGACNNNCCNCNCNCNACTNCNCCA
NNCNNNNNNNCNAANGCTTNctccncncnanccccnngtnncttngtnaccnngcntttt
ttccccnnccncgnnnnntnnnnnncnnttnnnntnnntnnannntccctntgtngcncc
ccnnnccnnnnntnccnnnnnnttctnnccncnncgnnatnnatnttgnnnnttcntatt
ntcncctnncncnntnatgnnnnntccnntggggagnnnngntanangtttggccgnnna
tccgnannanacngagcaaaanaaat

Library Name / Clone Name np / np55533_0309
Strand Minus
Insertion Point 17855318
Chromosome Band 3R
Flanking Sequence
gaagcatcgttagtggatgtctcttgccgacgggaccccttatgttatttcatcatgGAC
TGGGCGAGCGTGGGCCTGAAAGTGGCACATTTTCGCGAGCGACAGACGAAATAAAAAATC
GCAATCGGCCAAATTTGGGGAGGCGACTCAGCTCGACTCGACGGCGACAACAATAAACAT
TTGAAACAACAAGCGGCAAATAAGGAGAAGTCACATCCGCATCGAGAGATCCTAGNNCNN
GNGCTTTGCNCACTNGCNAATTATTNAAANTNNAACTTTAAACATGANTTCCANNNATTA
ATTANANAAATNACTTAAAACCCCANACCCNNNCCGNANGNTNAGNNTTAANTNAAAAAC
ANAGGGCNGNGNNNCTAATTATNCAAAANNCCNAANTNNTACNNGNNTCCNNNNCCCTAN
CNNNCNNTGCCNGANNNCGGNTTNNANGNNTNNAANACCNNTTNNNNNTNNNTTNNCTTN
NNNAANNCCTCNCNCNNNTTNNNAANNNNNNNCNTTTCCNNNNNNTNANNNNNNNNNNNN
CCNNNNNNNNTNNNGNNCNNNNANNNNNNGNNNNANNNNNCCCNNNNNNNCNNNNNNGGN
NNNNNNNNNNNNNNNNNNNNCNNNNNNNCNNNNNNNNNNNNANNNNNNNNNNNNCNNNNN
NCNNCNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNN
CNNNNNNNNNCNNNNNNNNNNNCNNNCNCNCNNCNNNNNNNNNNNNNNNNCNNNCTNCCC
CNNNCNNNNNNNNNNNNNNNntnnnnnnnannnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnccnccnnnnnnnnnnnnnntnnnnnnncnnnnnn

CLOSE