Detailed Information [103611]

Strain Information
DGRC Number 103611
Genotype with FlyBase Link w[1118]; P{w[+mW.hs]=GawB}crp[NP0409] / SM5
Genotype w1118; P{w+mW.hs=GawB}crpNP0409 / SM5
Break points/Insertion Site 35F1
Map Viewer
Related Genes pkaap crp 1360{}389
Original Number 409
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0409

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1209
General Information NP_lines
Lethality lethal
Embryonic Expression scattered cells
Larval GFP genital disc (subset of L3. may be stage or sex specific). cns + pns
Larval X-gal sg
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np10095_0727
Strand Plus
Insertion Point 16264585
Chromosome Band 2L
Flanking Sequence
ATTTTTGGGNNAAAACCCNTTTTTNGNNNNNNNNNGCCNNGNTTNGCGGNACCCCTTATG
TTTTNATNTGGNTGTCCCTTGACTATGTTTGTGCCTCACTGTTGCCCGTCTGCCGACACT
GCTGACAAATTGACAAAACAGCCGTTTTACAATATGGACGCCGAAAGGCAGAGCGTAAAA
ACAGCAACAACACAAACGCTGGACGAGAGCGGCGGGAAAAAAAGAGAGGATGTTGAGAAG
GGGGCNCAGACCCGAACGACGAGACAAAAANGGAGCACNTTTNTTCCAGCANCAAGAAAA
CGGCTTGGAAATGGAATGGAATGCGACACACGCTAGCTTGCNTGTGTGTGAGTGAGAGAT
GGGTCTTAATGGTGGTGGTGTTTTNGNGCCGTNTTTGTTTTGTCGGCAAAACGGCGGCAA
AANGCAAACGAGAGATTTAGAGAGAGCGCGAGTGATNCGGTGACGGANAAANGGGAGAGC
NCTAGCAAAGTAGTAAAAATAATCAATANTTTGNGNGATAAAAATGCAAGCCAAGCTGTT
GACTCGCCTTGTTTTTATTTGAAACAAAAGANATTTCGATTAAGATGCATACTTACTGCA
ATTCCTCATCCAATTCCTCGGCGCTGTTGTATTCGGCGTGCTCTANAATAACTTCCTCCG
TTTTGATGGCAACCGGTNCGGNGGACATGTTTAATCGGGTTNGGGTNTTTGCTTACTATC
GGGGCCAAAATGTCTGNGCCNCGTGGTTTTTNGTGGTGGCGCTGCTACTGCTGNTGNTTG
ACGGNTCATAAACATTTGCAatttatttttagcctgttacctttnttgttttngacatac
catgcgtaaggtggtctnagctgttttttgtnttagcgggaaattgtttgcccgtttaat
tcaccttgnacacctngcctgccaccaaaaaaaaaaaaaaatgggtntggngggcccttt
tnc

Image Files
Disc

d1 (->Large)


CLOSE