Detailed Information [103635]

Strain Information
DGRC Number 103635
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP0521 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP0521 / FM7c
Break points/Insertion Site 16E1
Map Viewer
Related Genes CG15814 CG6506
Original Number 521
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP0521

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 419
General Information NP_lines
Embryonic Expression sg, a small # of cells
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np41295_0907
Strand Plus
Insertion Point 17581355
Chromosome Band X
Flanking Sequence
cttttttggggaaaaaacccatttttatacttcggtaagcttcggctatcgacgggacca
ccttatnttatttcatcatgGTTCAATGAGTTGAGTATTTCGTTCCCAGCGCAAGCAAAC
TTATCGATAGTCCCGATAACCAACCATGTTATTTTAGGGCCCGATAAGTAAACAACAATA
TATTGTTAAGTAAATGTTGTACGTAGGTTTTTAAGCGAANTNNACATGCAAACAGAGCAC
TGGGGCTCGCTGCCCGCAGAGGATGACGGCGGTCAACTGACGCCGGACAAATACGTGCCC
ACGGCGGCCAAAAAACTTAAGCTGGACCAGATTCGCCAGCGCGGAGATCNGANAANTCAT
AAGAGAGAACCGNCGCCAAANAACCCATTNTTGGTGGGGTTCGTTTTCAAGAAGGGCCAG
CCATTCGACNTGTTATNCTTTTNAGACCAATTNAATTCCTGAAGAGCNTCCCTGGGCATA
AAANNCAACCGNATTGGNGNGNTATCANGATGAGCCGGCCAGNCAATCNANCAANCNACT
NGGTTTGGCCTTNGTACTACTTTTTTCCCAANGAGANGGCNACTTATTNTNGCTGCTAAT
GGTGGGGGNTTTANCTCCTGAGCATTTTTTTTGNGNNNNNANNNNNNNNNNNGGGCNNNC
NNNNTTTNNNNNCCCNTTNGGNNCCCNNCNGGNNTCNNNCNTTTNTNNGGGNNNNNNNNN
NNCNNNNNNNNANTNNCNNNCNTNNNNNCNNNCNNNGGCTCCNTTNNNGGNNGGNNNNNC
TTTCNCNNNTTNNNNTNTTTtnncnnttnnnnncnnnnnnnnncnccncccnnnnnnnnc
nntnnnttnnnncctttnntnncnnncnnnncnnnnnncnnnnnnnntnnnncnncnctn
nnnaat

Image Files
Disc

d1 (->Large)

d2 (->Large)


CLOSE