Detailed Information [103637]

Strain Information
DGRC Number 103637
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}MESK2[NP0524] / CyO
Genotype w*; P{w+mW.hs=GawB}MESK2NP0524 / CyO
Break points/Insertion Site 57E6
Map Viewer
Related Genes CG10494 CG10496 MESK2 Fkbp13
Original Number 524
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0524

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 902
General Information NP_lines
Lethality lethal
Embryonic Expression pns subset?
Larval GFP pns
Larval X-gal gut
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np52435_0227
Strand Minus
Insertion Point 16545678
Chromosome Band 2R
Flanking Sequence
gaattaagtgttcttcggtagcttcggcttcgacgggaccccttatgttatttcatcatg
ATGCAGCGCAAAGCAAATTTGATAGTGATGGGGAGAAACATCGATGCATCGGGAATCGAT
GTTTTCATATAGGTGCTATCGAGCTAGCCGATATTTTAGAAATAGTATCGCCGACCAGCG
ATACATCGTCGCTTATCAAAACATCGGATTCTTAAATATTTTTGACTTAAAAATGTAAAT
GTTACTTATTATTGGTGTCTAAAACCTTTACATTTCTTTAAAAAGGTATTTTACGATGCT
TTTTTTTTCAATGTTACATTTTTGCACTTCCAATGTAATGTAATAGATAATCCAAAACCT
ATATTATTTTAATATATTGTGAATATTTTGCTTGTAATGCTCATAACAGCAAGCATGCCG
GTTGGCTAGACATAAATACCCATCACTAAACAGCTGTTTCTTGCGTCCAGAGCAAACGTC
GTGCGTTTGGCGTTTGATTGAGTCAAATTCAATTTGGTAACTAAATTCTTTCGTGCAGAA
CTGGAGAGCTGCTCTAAGAAATCCGTAAGCCAGGCTCACATGCATCAGAACACATCGGCC
AGCTAGCAAAATCCGATTTATTATTTATACTCCAATACAGACATGCCGNGACGCTATCAA
ACAGCTNTCAATTCGGNCAAATACAGNGCCCAGGTCAAGACCAAACCTAGNGACACCGAA
TCCGATTCCGAGATGATCGAGAATNCTAAGAGAGACCCGGCGCCAAAGAACCATTATTGG
TNGGGGTCCGTTTTCAGGANggcagccatccgaatgtnatccttttagaccatcaatcat
gaagagcatcctgggcataaatcacggattgggngtntcatgaggctgcggtnatcgaac
agcactgntt

Image Files
Disc

d1 (->Large)


CLOSE