Detailed Information [103686]

Strain Information
DGRC Number 103686
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}cib[NP0635] / FM7c
Genotype y* w* P{w+mW.hs=GawB}cibNP0635 / FM7c
Break points/Insertion Site 4A5
Map Viewer
Related Genes brn cib EG:EG0007.9
Original Number 635
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP0635

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 125
General Information NP_lines
Lethality semi lethal
Embryonic Expression cns subset+ pns subset
Larval X-gal sg, tr
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np25215_0807
Flanking Sequence
GGNNNNNNNGNNGGNGGGNNGNNNGGGNNGNGNNNNNGNGTTTTTGGNNNGATTTCTNNG
GGAANANCCCCTTNTTGGGGNNNNGGAAANCCCNGGCNATNGACGGGACCACCTTTTTTG
GGGGNANNANGCGNGGNNGGTCCNNAGGNGAGGNCNNCANCANCANCNNCGGTGTNTNCN
NGNGNGGGGGGAGCNNNGGNGANNNGGGGNGGNGNGGGGGNGANNNNNANGGGGGNGGGG
GNNNNGANGNNNGNNGNGNNTTAANTTTTTTTTTTTTTNNNNNGNNNNNNGGTTGTGGGG
GGGGGNNGNNGNNGNNGNNNNNNNGNNNNNNGNNNNNNNNNNNGGGGGGGGGGGGGNGNN
CNNNNGNGNNNNNGNNGGNNGGNGNNNNNNNNGNNGNNNNNNNNGNNGNGNNNNGNNNNN
NNGNNGGNNNNNNNGNGNNGGGNNGNGGNNNGNNNNNNGGNGGGGGGGNGNNNGGNNNGN
NNGNNGNGNNGNNNGNGGGNNGNGNNGGGNGNNGGGGGNGNGGGNGGGGGGGNGNNGNGG
NGGGGNGNGNNGGGGGGGNGNGNGNGGGGGGNNGGGGGGGGGGGGGNNNNGGGGNNGGGG
GGGNGGGGGGGNGGGGNGGGGGGGNGGGGGGGGGGGNGGNNNNNNNNNNNNNGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
gnnnaaaaan

Library Name / Clone Name np / np60703_0309
Strand Plus
Insertion Point 3848639
Chromosome Band X
Flanking Sequence
tttactgcgcacttattgcaagtcatacgttaagtggatgtctcttgccgacgggnacca
ccttatgttatttcatcatgGGTGCAAGGAGCTGACTAATAAGACACTCGTTTACACGAT
GACCAATTAATCGAACTTTAAACGGAGCGATCCGCGGCCGGCCGCATAGGCCACTAGTGG
ATCTGGATCCTCTAGCTAGAGCTTTGCGTACTNGNAAATTATTNAAAATAAAACTTTAAA
AATAATTTCGTCTAATTAATATTATGAGTTAATTCAAACCCCACGGACATGCTAAGGGNT
AANNAACANNCATATNGCTGTNTCNCTCTNACNCTANNNGCCANTANTAATNANATNTCT
NTTANTATNACNNTTGGNNANNGTANTTNANNNGGNGGTNNNNNTCACNNNNCNNNCNNN
NNNNANNTNNNNTANNNNNNNNNNNNNNCTNCNNNNTNAGANANTNGNNNCNCNANGNTT
NNNNNNNNNNNNTTNNNNNNAGNNNTCCNNNNNNNNNNNNNNNNGNCNCTNGNNANNTNN
NANNNNNNTNNNNNNNNNNNCGNNNNNNNNNNTNNTNNNNNNNNNNNNNTNNNNNNNNNN
NNNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNnnnnnnnnnnncnnnnnnnnnnnnnn
nnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnannnnnnnnnn
nnnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnn


CLOSE