Detailed Information [103687]

Strain Information
DGRC Number 103687
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}CG10990[NP0636] / FM7c
Genotype y* w* P{w+mW.hs=GawB}CG10990NP0636 / FM7c
Break points/Insertion Site 12B9; -; 12B10
Map Viewer
Related Genes l(1)dd4 CG10990 CG32625
Original Number 636
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP0636

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 329
General Information NP_lines
Embryonic Expression muscle subset
Larval X-gal fb
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np18135_0807
Strand Minus
Insertion Point 13485488
Chromosome Band X
Flanking Sequence
gtttttttttnngnnnatttacttngngtgncactagaccntttnttgtatacttncggt
aagccttcggctatcgacgggcaccaccttatgttatttcatcatgGTAAGTGGCAAAAT
AAAAAAAAACGCAGAAACAGCAGCAGCAGCAACAACAACATCgatcgaagaatacataag
agagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagcca
tccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaa
tccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgt
ctttgacctttgttactactctcttccgatgatgatgtcgcacttattctatgctgtctc
aatgttagaggcatatcagtctccactgagcatnttttttttnggggnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)


CLOSE