Detailed Information [103746]

Strain Information
DGRC Number 103746
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Spn6[NP0755] / CyO
Genotype w*; P{w+mW.hs=GawB}Spn6NP0755 / CyO
Break points/Insertion Site 55B7
Map Viewer
Related Genes Spn6 Dip3 stau
Original Number 755
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0755

NP line. Received from the National Institute of Genetics.

Balancer CyO;TM3 Ser
Cluster id 841
General Information NP_lines
Embryonic Expression cns, muscle
Larval X-gal sg, tr (all)
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np25585_0807
Strand Minus
Insertion Point 13190166
Chromosome Band 2R
Flanking Sequence
ggggggnnagggnnttgttnngtttnttttgngnngantcncgcggnttgtanagtnccc
ctctaacngggggctnncggtaagactcccggctatcgacgggnaccaccttntnttatt
tcatcatgGACTGAACTGAGTAATTGTGGGTGTGCTGCGTAATCGCGGAACTGCGTGTGC
TTGCTCTCTGGTCTGCTGTCTACACCGGAATGCCTTAAATGCCATTCGGGGCCACAACAA
AAGTGAAAACATCGGCCAGCCGGCGANTGAGTCACAGCCAAAATATTATCAAAACAATCG
AAGCGAATTGGTGGCGTCATCATTTTCATgatcgaagaatacataagagagaaccgtcgc
caaagaacccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcat
cctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattg
tggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgacctttgt
tactactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggca
tatcagtctccactgagcatcntnnttttgggnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnn


CLOSE