Detailed Information [103749]
 

Strain Information
DGRC Number 103749
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Baldspot[NP0762] / TM3, Ser[1]
Genotype w*; P{w+mW.hs=GawB}BaldspotNP0762 / TM3, Ser1
Break points/Insertion Site 73B5
Map Viewer
Related Genes Galpha73B Baldspot snRNA:U12:73B
Original Number 762
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP0762

NP line. Received from the National Institute of Genetics.

Balancer TM3 Ser
Cluster id 1938
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression muscle subset
Larval X-gal sg, fb
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np10765_0727
Strand Plus
Insertion Point 16610503
Chromosome Band 3L
Flanking Sequence
atcctttggggggaaaaagccnnttttttgtatacttcggtaagcttcggctatcgacgg
gaccaccttatgttatttcatcatgGTTCGGCTGCTTTATCGCTATACTTATATATAGGA
GATATTTTAGTACCAATCATGGCGCTGGTACTTTTGCCATCGCGGTATTTTTCTGCGGCT
CGCGTGCGGTCACATCTAGCTGCGTGCGGGTGGCGCTCTATGNNCACTGGTTCCACTCCA
ATTGGGTACTAGTCAAACTTACTTATGTTGCAAGGAACAGTTAAGCCACTAGTGTCTTTG
GTTAAGCGTAGCAAGATGCATTTGTATGCCCAAATTATTAAACAGNATCGCGAGTTATAC
AGGAATATTTTTGNTTTATGGNTATACCCGACATGAAGCGTTAAAATGNTTGGGGAGAAC
GTAAGCTGGTAAAAGGTAAAACGATGATCGAAGAATACATAAAAAANAACCGNCNNCAAA
NAAACCCATTATTGNTGGGGGNCCGGTCTTCNGGAAGGGCAAGGCCATTCAAACCNGGGN
AATNCCTTTTNNNACCAANCAAATNCATGGAAAGANNCCCCCNGGGCNTNAAAATCCCAC
CGAATTTGGGGGGGNTATTCANNNNGGGGCGGGCCGGGCAATTCAACCAANCNAANGGNN
NTTNGNNCNTGGGTNNAANCNNTCNCTCCNGGGGGGGAGGGCCCCCTNAATTTTNTNCCG
GNCCCNAANGNNGNAGGGNATTAAAANCNNCCCCNNAAACCAANAANTTTTNNNGNNNNN
NNNNNNNNNNNNNNNNNTNNnnncnnnntntnnnnnnnnncnnnnnnnncnnnnnnnnnn
nnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncgnnnnn
nnnnntnnnnnnnnccntnnnnnnnnnntnnnnnnnnnnnnnnnnnnanccnntnttttt
nnntnnnnnntntntnnnnnnnnnnnnantannnncccaanaaaaaaaaatn

CLOSE