Detailed Information [103780]

Strain Information
DGRC Number 103780
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Ef2b[NP0829] / CyO
Genotype w*; P{w+mW.hs=GawB}Ef2bNP0829 / CyO
Break points/Insertion Site 39E7
Map Viewer
Related Genes Ef2b CG31619
Original Number 829
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0829

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 1301
General Information NP_lines
Embryonic Expression sg
Larval X-gal sg
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np41095_0907
Strand Minus
Insertion Point 21515266
Chromosome Band 2L
Flanking Sequence
ttncgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccacct
tatgttatttcatcatgGTCCCAGCTCTATGGTCGCTGCAGCGCCTCGCTCTTTCCTGTC
GAAACGCCGTTGAAAGGCGTAGTGTTTTTTTGGTCCGCGAGAAAATCTCCATACATCCAA
AATGGTAGGTGCCCAAAGTCAGAAATAATAGCCCCATATCTACAGAAAAGGCCTAGAGGC
GACCTGCATTAATATCTTTAATGCCCAGTGCAAAAAGTGCAGATGTCTCAACCATTACTT
GGTGAAATGATGTGTCCACATATTTTCACGTTTGCTTGTTGTGTGTGTGTGCATTATGGT
GAAATGCAAGACAAAGACTAGGAATGACGTATGCAATTTTCTATTGAAATTTGGCTAGAA
TGTgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtcc
gttttcaggaagggcaaagccatccnacatgtcatcctcttcagaccaatcaaatccatg
aagagcatccctgggcataaaatccaacggaattgnggagttatcatgatgagctgccga
gtcaaatcgatacagtcaactgtctttgacctttggtactactctcttccgatgatgatg
tcgcacttattctatgctgtctcaatgttagaggcatatcagnctcactncatnnnnnnn
nnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaaccgnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnn


CLOSE