Detailed Information [103783]

Strain Information
DGRC Number 103783
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP0837 / SM6a
Genotype w*; P{w+mW.hs=GawB}NP0837 / SM6a
Break points/Insertion Site 39E6
Map Viewer
Related Genes cul-2 invader4{}511
Original Number 837
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0837

NP line. Received from the National Institute of Genetics.

Balancer CyO;TM3 Ser
Cluster id 1300
General Information NP_lines
Embryonic Expression sg
Larval X-gal sg, brain
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np39635_0907
Strand Plus
Insertion Point 21490945
Chromosome Band 2L
Flanking Sequence
GNTCTTCGGNAGCTTCGGCTNTCGACGGGACCCCTTATGTTATTTATNATGGGTCAAAGT
GAAATGTGTGGATGGCCTTTGGAAGCTACAAAGGCTGGAAATAGTGGTAGGCGATGTGCC
AATTTTTGGCGCATATGGAAGGTTGCAAGTATTGATCGAAGAATACATAAGAGAGAACCG
TCGCCAAAGAACCCATTATTGTTGGGGTCCGTTTTCAGGAAGGGCAAGCCATCCGACATG
TCATCCTCTTCAGACCAATCAAATCCATGAAGAGCATCCCTGGGCATAAAATTCAACGGA
ATTGNGGAGGTATCATGATGAGCTGCCNAGTCAATCGATACAGGCAACTGNCTTTGACCC
TTGGTACCACCCTCTNNCCAAGAAGAAGNCCCNCTTTTTNTNTGCTGGCCAANGGTTNAG
GCAAATAAACCNCNCTGGNACCATCTTTTTTNGGNNNNNNNNNNNNNNNNNNNNNNNNCC
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE