Strain Information | |
---|---|
DGRC Number | 103857 |
Genotype with FlyBase Link | y[*] w[*] P{w[+mW.hs]=GawB}Rip11[NP1015] / FM7c |
Genotype | y* w* P{w+mW.hs=GawB}Rip11NP1015 / FM7c |
Break points/Insertion Site | 17C7 |
Map Viewer | ![]() |
Related Genes | wgn CG6540 CG6606 |
Original Number | 1015 |
Chromosome | 1 |
Comments | FlyBase Insertion: P{GawB}NP1015 NP line. Received from the National Institute of Genetics. |
Original Comments | comment1:A, comment2:17C5 |
Balancer | FM7c |
Cluster id | 431 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | pns subset, cns (SG) |
Larval GFP | ubiquitous |
Larval X-gal | epi, fb, gut |
Adult GFP | no specific pattern |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np19525_0807 |
Strand | Minus |
Insertion Point | 18378271 |
Chromosome Band | X |
Flanking Sequence | antntctttgggngaaanaccccttttttgtatacttcggnaagccttcggctatcgacg ggaccaccttatgttatttcatcatgGGCAGGACCTTCGCAGCAAGAGCGAGACAGCAAA Ggatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgt tttcaggaagggcaagccatccgacatgtcatcntttttagaccaatcaaatccatgaag agcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtc aatcgatacagtcaactgtctttgacctttgttactactctctnccgatgatgatgtcgc acttattctatgctgtctcaatgtnagaggcatatcantctccactgaagccatcttntt ttgggggnnntntnnnncctccactgaagccaatnnnnnnnnngnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnn |