Detailed Information [103867]

Strain Information
DGRC Number 103867
Genotype with FlyBase Link y[*] P{w[+mW.hs]=GawB}ph-p[NP1046] w[*] / FM7c
Genotype y* P{w+mW.hs=GawB}ph-pNP1046 w* / FM7c
Break points/Insertion Site 2D3
Map Viewer
Related Genes ph-p EG:87B1.3 FB{}23
Original Number 1046
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP1046

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 59
General Information NP_lines
Embryonic Expression a part of brain (SG), a small # of cells
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np17235_0807
Strand Minus
Insertion Point 1891361
Chromosome Band X
Flanking Sequence
gnnnnnngnnggnggnggnnnnnngngggggggngagggntttttngttttnnctttngg
gganncnnacacggcgtgnttattggcncccnnaactnggngactnncggtaaaacnttc
ggctattcgacgggnaccacntttatgttatttcatcatgGGCCTNGCGGGCTTTTTGGG
CGATGGAAAGGGGTGGGgatcgaagaatacataagagagaaccgtcgccaaagaacccat
tattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagacc
aatcaaatccatgaagagcnggcntgggcataaaatccaacggaattgtggagttatcat
gatgagctgccgagtcaatcgatacagtcaactgtctttgacctttgttactactctctt
ccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctcca
ctgaagccatcttnntttttgggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE