Detailed Information [103873]

Strain Information
DGRC Number 103873
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}ari-1[NP1063] / FM7c
Genotype y* w* P{w+mW.hs=GawB}ari-1NP1063 / FM7c
Break points/Insertion Site 16F7
Map Viewer
Related Genes ari-1 CG5744 1360{}154
Original Number 1063
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP1063

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 423
General Information NP_lines
Embryonic Expression scattered cells (SG)
Larval GFP sg, fb
Larval X-gal sg
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np19035_0807
Strand Minus
Insertion Point 17868149
Chromosome Band X
Flanking Sequence
ttnangtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccacc
ttatgttatttcatcatgGGCCCTGTTAAGCGCACGGGCCAGTGTGACCGTTCTTCTTAA
AAATACCGAACCAGTATGACTGCGCTGCGACCGTGCAGGGTCTCGTATTGTCATTAGAAA
ATCTCACATATTCATTTTTCATTTACAAATAAAAATAGCCAGCACGCAGCCTACAAATTA
GCAGCGCACAAAATAAGTTAGTGTGAAAAAGGGAATAGAAGCTGTGCACCAAGTGCAGCG
ACCAAACACAACTGGCCACGCCACTGCGAGGGCAGCAATAATAACAACTGGCGAAAAGGG
CTGCGCAAAAACGTAAACAAAAGCAAGTGGAAAACGAGGCAAAGGAAAACGAAAAGACAG
AAACAAACGCAAATGCAAATGCAAAAGTAAAATACTGGAAGTAAACGCTGGAAAACAAAG
CCTCGAAAGCTGAAAACAAAGAGGAACCGGAAGTGGTGCGGGAGGCGCAAGANGAACAGG
AAGAGGAAGAGAGCAGAAGGAGCACCAGCAGCTGAAGCAGAAGCAGTAACGCAAAACAGA
AACCCGAAAAATGGGCTCGGACAATGACAATGATTTCTGCGATAATGTCGATTCGGGCAA
CGTNTTCTTGGGCGACGACNGNNATGATGACTTTTGCATGGGNGGNGGACCTGNCAGCTT
CCGNGGACCGNCAGATGGACCCAGATGACTTCCNGTNCCANGGGGGCTCACCANCCGATG
GGAATTGGGCCACANCCGCGcggggttctaanaatanatnaaaaagaaccnnnngaaana
accatttttgntngggggcccntttcnggganggnaagcccttccncaattttatctttt
ttnnnccancaatcctggagggct


CLOSE