Detailed Information [103885]
 

Strain Information
DGRC Number 103885
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP1106 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP1106 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 35D4
Map Viewer
Related Genes BG:DS09217.4 Gli
Original Number 1106
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1106

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1203
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression pns subset (ch) (SG)
Larval GFP sg
Larval X-gal sg, gut
Adult GFP ubiquitous
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np17385_0807
Strand Minus
Insertion Point 15740851
Chromosome Band 2L
Flanking Sequence
attttnagcgtgcactgnatttangtgtatacttcggtaagcttcggctatcgacgggac
caccttatgttatttcatcatgGGTTGGCGCGTCAGTTCGTCGGCAGCGTTCGAAAGAGT
CGGTTGCCTTTGTGTTTTGGCGGTAGTGGTTGTGCGCACAGGTGAGAGTTCGGTGCGCAA
GAGGCCGTTAAAGTTAAAGCTGCGCGCGCTCAATACAACGAAAGAATCGGTTGGCCAGGT
GTATCTGTGTGCGAATCGTTGGTAACAGCCGGCAACTGAGTGTGAGTGTTAACTGAGTTT
CGTTCGTTGGTGTGCGTGAGAACTGAGAAGTGGTTTTTGGACGGCACATTGCGCTTACCT
AGCTTACCTGAGTCTCAGTCTCCGCCGCCGACTCAAAAACGGTCATTTCAGCTGCGTTAC
GTTTTTTTCTCGCTTGTATTCAGTCTTGTTTTTGGTTAGTGATTTTTTGTTTGTTACCTT
TTCGGGGCGTTGGCCAAGAAAGTTATTGTGAGTGTAGAAACGCGTAAAAGTTGAAACCAA
AATGTGAGTGGTAATGGTTGGAAAATCGCGATTAGATAGATAGTGAAATGACGGATAGAA
GCCGCAACAAGTTGCCACGGCAACGTCATCAATTGGAGCATAACTGTAAAAACAGTGAGA
TTAAGCCNCACAGAGAAAGAATACCCTTGCATTAGNAACAAAAACATTTTTAAAAAAAAC
TGGTTTTNTAACAAAACTTAAAGAAAAGGGGAGCTTCCAAAATAAATTTACCTTNAAAAN
AATTATTAATTTAAAAAGAAaagtttttgctcctgnccctttgtntntccaaaaattttg
tttaaaaaagcntnccgatttttttccggccttgggnaaaacaac

CLOSE