Detailed Information [103887]
 

Strain Information
DGRC Number 103887
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}SP2637[NP1111] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}SP2637NP1111 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 55E6
Map Viewer
Related Genes CG5469 SP2637
Original Number 1111
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1111

NP line. Received from the National Institute of Genetics.

Original Comments comment1:A, comment2:53E5-E6
Balancer CyUW14
Cluster id 857
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality semi lethal
Embryonic Expression oenocyte (SG)
Larval GFP sg
Larval X-gal claw
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np17415_0807
Strand Plus
Insertion Point 13717868
Chromosome Band 2R
Flanking Sequence
ttttnaagngtgcactgcaatttaagtgtatacttcggtaagcttcggctatcgacggga
ccaccttatgttatttcatcatgTGCCAAGGCAGCTCTTATCGCGCCCTCTCTTTCTCTC
GCCCCCATTGCCCGTCTCTTTCAGCATACGAGAGCGTGTGTGTGTGTATGTGTGTGTGTG
TGTGNGAAGCAGCATGCGGTCCGTCGACAAAAAATGAGATTTGCTGACCGGNGGTCATTA
AAGCACATTTACAATGAGCCAAGCCATGTTGGCTTGTGGCTAACATGGTCTTAGCCAAAC
TTAGCCACCCCGCCCNCTTCATTTCACACAGCCATGCAAAATGACCACAGAGACAAGCga
tcgaagaatacataagagagaaccgtcgccaaagaacccattattgttgggggtccgttt
tcaggangggcaagccatccgacatgtcatcctcttnagaccaatcaaatccatgaagag
catccctgggcataaaatncaacggaattgnggagttatcatgatgagctgccgagtcaa
tcgatacagncaactgtctttgacctttgnnactactctcttncgatgatgatgtcgcac
ttattctatgctgtctcaatgtnagaggcatatcagtctncactgacatnnnnnnnnnnn
ggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)

CLOSE