Detailed Information [103900]

Strain Information
DGRC Number 103900
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}Galpha49B[NP1136] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}Gα49BNP1136 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 49B8
Map Viewer
Related Genes Galpha49B Amph
Original Number 1136
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1136

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 709
General Information NP_lines
Lethality lethal
Embryonic Expression epi, muscle subset
Larval GFP tr
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np17475_0807
Strand Minus
Insertion Point 7677808
Chromosome Band 2R
Flanking Sequence
gnnnnnngnnggnggngnnnnnnngggggggngggagggnttnnngttttncctttgggg
ganncnacnggccnngtaanngcncccnnaantgggggactnncggnaaaaccctcggct
attcgacgggnaccacntttatgttatttcatcatgGTTTAACTATTATGGGGGGGCCTT
GCTTAATGGCCAGCACTGTTTGGCGAAAAAATACACTTTACACTGGCATTTCGGGGAACG
TTTTCGGTGCTGCTAAATTTTTTTTTNGNCGAGGGGGGGACTTTTTCGGGNGGCTGCCAG
GCGGCTGCGGANGGGGNCNGCTGGCTGGCGGGNAGNCCGTTTGACGGGGATCGAANAATA
CANAANANANAACCGNCGCCAAANAACCCATTATNGNNGGGGNCCGTTTTCAGGAAGGGC
AAGCCATCCGACATGTNATCCTNTTCANACCAATCAAATCCATGAAGAGCATCCCTGGGC
ATAAAANCCAACGGAATNGGGGAGTTATCATGANGAGCTGCCGAGTCAATCGATNCAGNC
AACNGNCTTTGACCTTGGNNACNACTCTCTTCCGAGGANGANGNCGCACTTATTCTATGC
TGNCTCAANGTNAGAGGCATATNAGNCTCCACTGAAGCCATNNNNNNNNNGGGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE