Detailed Information [103921]
Strain Information
DGRC Number 103921
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}CG9945[NP1184] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
y* w*; P{w+mW.hs=GawB}CG9945NP1184 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 57A7
Map Viewer
Related Genes CG11180 CG30147 CG9945
Original Number 1184
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1184

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 885
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression sg
Larval GFP fb, tr
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]

Library & Clone Information
Library Name / Clone Name np / np16575_0727
Flanking Sequence
ATTTTNNGGTGCACTGACTTTNNGTGTATACTTTCGGTAAGGCTTTCGGGCTNTTCGGAC
GGGGACCNCCTTTANGGTTNTTTTATTCATGGGGCTTTTACCAGGANGAATTAGGCGGTG
AAAGANCACCATTTTGGTTTTTTCNGGACCACCNGGCCTGGGNTTTAANCGTGGATCCNA
NAANTCCTTANAAAANANCCGTCCGCCAANGAANCCNNTTNTGGTGGGGGNCCGTTTTNA
GGANGGGCAGGCCTTCCNNCNNGTNATCNTTTTNAGACCAATNAANTCCNTGANGAGCNT
CCNTGGNCNTAAAATCCAACGGANTNGGGGNGTNATNATGANGAGCTGCCGAGTNANTCG
ATNCAGCNAACTGTCTTTGACCTTGGTNACTACTCTNTTCCGATGATGATGTCGCACTTA
TTCTATGCTGTCTCAATGTTAGAGGCATATCAGTCTCCACTGAGCATNTTTTTTTTGNGG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np57953_0309
Strand Minus
Insertion Point 15682442
Chromosome Band 2R
Flanking Sequence
cttttactgcgcacttattgcaagncatacgttaagtggatgtctcttgccgacgggacc
accttatgttatttcatcatgGTATAGCCAATTGGTTCCCCATAACTTTTTGCGTTTTCC
CTTTTGCACTCTTTTGTTATTAATTTCAACCTATCGTTTCTTCGATAATTGTTGCAGCCA
GTGAGACCGCAGGTGAAGAGCCTGAAAATACCACGATGTTCAAGTTCAAACGTTGAACAC
CTATCGATCCTCTAGCTAGAGGCTTTGNGTACTCGCAAATTATTAAAAATAAAACTTNGA
AAATNATTTCGTCTAATTAATATTATGAGTTAATTCAAACCCCACGGACATGCTAANGGT
TAANCAACAATNANATCCNTGGNTTNATTNAAACNNANNNNNAANNNNNAANNNNANTNA
CNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNGNNNNNNNNNNTNNCNNNNNNNNCNN
NNNNNNNNNNNNNNCNNNNNNNNNNNCAANNNNNNNNCNNNANNNNNNNNNNNNNNNNNN
NTNNNNNNCCNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNTNNNNNANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnn

CLOSE