Detailed Information [103935]
 

Strain Information
DGRC Number 103935
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP1211 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
y* w*; P{w+mW.hs=GawB}NP1211 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 42C1
Map Viewer
Related Genes Vha16 jing invader1{}757
Original Number 1211
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1211

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 535
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression sg (SG)
Larval GFP sg
Larval X-gal sg, tr
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np03675_0711
Flanking Sequence
ttttggtgcactgnccttaantgtatacttcggtaagcttcggctatcgacgggaccacc
ttatgttatttcatcatgGNNCGNACCATGANNAAATACNNTAAGGGGCCGTGTNCANAG
GAAGANAANCCANCNGTNGAGCCATANCTATTGAGCANCNGNATAAGCCATGNANTAGCN
TGCCGGTGGTATAAGATCCANCGGNAGNTCTGCGNNNCATNATGTNNANGCACNCGNNAN
ANTGCGATTCACGNGNCNGANGTGTGACCTTCAGTACGNANTCTNTNCCNGNNNATGNGG
NNGCANCAATNCTATGCNCCTNCCGANGNNAANTAGNCNTATTANTNGNTCNNNGGAAGC
CCGNNTNNNGAAGNNNGNANNATACAGNNGGNCGANAGANANNGGGAGAGNANGGAGANT
AGGAGNNGNNGNGANAGAGAANGNANGNNNNANNTTNCANNTCTNNTCANNATTNTTTNN
CANNNNTANTTANNAGATNTNNTNTNNNNTACNNNGAGNNNTNNANTNTTNTNNGNGNNN
NNNTNNTAATGNGNNNANNGNCTCNNNNNNNNAGTNNNCANGTNNATATNNCGCCGNAGA
GNNCGNTCATNGANCACNNTNTTNNNCTNNTNNAACTNNGACTGNANACTCNNGGGCCCG
NTNGTGNNTNNCGAGTANNNNNGNGGTTGCGNNNTNCCCAANAANCCNANTNNNNAGNNN
GNCNNTNCCNNATTTNGNATTAAAANAANATNGNGGNTTGNCNTNCCTCNCNCCNCTGTT
TTNTACGNCTGACTNCNAGCntntnancntngtatancgcnnnntgtnggcnntaattgg
ctcannnncnntnngtatctnnnanngctntnntcnnnnntnngngctancntngtnnnn
cnnncncgcnnntgtnnnttnatntngntnnnacnnnanntancntnnccgngnngtacn
cgnnaanngcgcccgncnccgccncnnnncnctnntnanatgctcgngtggtcnncccng
tancnagnntnntccgggnacgnccannantgnnacgctntanangccatctnntntgcn
gtnnntnggnctnnnnttgtnagacgnnntnnnnannntnggnangg

Library Name / Clone Name np / np54403_0309
Strand Plus
Insertion Point 1683250
Chromosome Band 2R
Flanking Sequence
ttttttctgcgcacttattgcaagtcatacgttaagtggatgtctcttgccgacgggacc
accttatgttatttcatcatgGTCTGTACGAAAACNAGAAGCATACAGAAAAATGCGGTG
TGCATAAGTATTGGTGTATGCTGACTAGAACAACTGTCATAATTGTGTTGGTATTGCATG
TAAAGTCAAGAACTACGCATAATTCTGATTTTGTGAAGAAGAGATCCTCTAGCTAGNGCT
TTGGNNACTAGTGGATTATTAAAACTCTAACTTNAGNATTAAATTTCNNNTNATTATANT
ATGAGGNGNTNAAAAAAACCCCACCNNCCTGCTNNGGGTTAANNAACAATAANATCGCTG
TNTCACTCAAACCNNNNGGNCANGTTAAAGGTNAATNNTTTNTTTATCNCTNNNNNNNTG
AAANCCNNNANNNNNNNTNANTTTTNNNGNNNNNTTNTNNNNNTNNNNTNNTNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNTCTNNNNNNNNNNNNNNNCNNNNNNNNNNNNNN
TNNNNCNNNNNNNNNNNNNNNNNNNNNNNTTNTNNNNTNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTNNNTNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNTNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNnnnnnntnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnnnnnn
nnnnnnnnnnnnnncncnnnntnnnnnnntnnnnnnnnnnnnnnnaaaaaaaaaaaaan

CLOSE