Detailed Information [103939]

Strain Information
DGRC Number 103939
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP1216 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP1216 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site ---
Map Viewer
Related Genes CG40191 CG40192
Original Number 1216
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1216

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 2085
General Information NP_lines
Lethality semi lethal
Embryonic Expression weak (SG)
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np03725_0711
Strand Plus
Insertion Point 2141546
Chromosome Band U
Flanking Sequence
attttaacgtgcactgnanttaantgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgCCTGGGGCGACCTCTAGAGCCACGCCGAAAGAAACGCAA
ATAAAACGTATGGGAGTTACGgatcgaagaatacataagagagaaccgtcgccaaagaac
ccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcctcttca
gaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgtggagtta
tcatgatgagctgccgagtcaatcgatacagtcaactgtctttgacctttgttactactc
tcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcatatcagtc
tccactgagccatcttnntttttggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np54413_0309
Strand Minus
Insertion Point 2141553
Chromosome Band U
Flanking Sequence
atntttgctncgcacttattgcaagtntacgttaagtggatgtctcttgccgacgggacc
accttatgttatttcatcatgGCCCCAGGCATTCTCGAACTTTTGTTCAAGAGCGAGAGA
GCGGAGAGAGCTCATGCAGTGTAAATTTCACAAAATATGCTCTTCATCTTAGAAGTTCTT
ACACTTTAAATCTATGTATATTATTTTTGATCCTCTAGCTAGAGCTTTGNGNACTCGCAA
ATTATTAAAAATAAAACTTTAAAAATAATTTCGGGTAATTAATATAATGAGTNAANTTAA
ACCCCCCGGGCANGCNCNNNGGGNNTANAAAANNANTATATCGGTGTCTCANTCAAACCC
ANNGNANCNCTTAAGNTACNATCCNTTANNNTCCCACTTTTTGANNGCATNCCAAANGNG
GAGGTCNCTGNCNNCGGNANCCACTTTNACGNTNTGNANTNANGNCCCNCNNNNTGGGNN
NAANTTTNNNNNAAAAACCTGNGACNNNNAAAGCCNNNAACACNNNGNAANTCNCCAAAA
NTNGGNNNTTNNCCCNNNAAAANNANAANACNCTTNAANTNTTNGNNNTTTNNNNNNNGN
NNNCNNNNAANNNNCNNNNNNNNNNNNNNTNNNNNNNNNNGNAANNNTNAAANGGGNNNN
NCNNNNNNNNNNNNNNNNNNNNGNNNNNAAAAAANNNNNNNNNNNNNNNNNNNNNNANNA
ANNGNNNNNTNNNNNGNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnanngnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncccnnnnnntttt

Library Name / Clone Name np / np70275_0810
Strand Plus
Insertion Point 2141541
Chromosome Band U
Flanking Sequence
cgtgcactgnatttantgtntnacttncggtagncttcggctatcgnacgggnaccacct
tatgttatttcatNCATGCCTGGGGCGACCTCTAGNGCCACGCCGAAGNAAACGCAAATA
AAACGTATGGGAGTTACGGNatcgaagaatacataagagagaaccgncgccaaanaaccc
attattgttggggnccgttttcaggaagggcaagccatccgacatgtcatcctnttcaga
ccaatcaaatccatgaagagcatccctgggcataaaatccaacggtaattgtggagttat
catgatgagctgccgagtcaatcgatacagtcaactgtctttgacctttgttactactct
cttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcatatcagnct
ccactgaagcctcttttttttggaantncnnnnntnnngnngangatgtcangcttancn
gatgctnnnnnnntgncagaggcntgtcnttnnccactgaancnantnnnntttnnnnng
angangncnnncttatnctatgctgnctnaatgntagaggcatatnannctncactgaag
ccatnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE