Detailed Information [103943]

Strain Information
DGRC Number 103943
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}B4[NP1222] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}B4NP1222 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 34C4
Map Viewer
Related Genes kuz B4
Original Number 1222
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1222

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1178
General Information NP_lines
Embryonic Expression AS, pns(ch) (SG)
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]

Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np03775_0711
Strand Plus
Insertion Point 13530781
Chromosome Band 2L
Flanking Sequence
antnttgggtgnaaacccttttttgtatacttcggtaagccttcggctatcgacgggacc
accttatgttatttcatcatgCCGAAAAGTAACGGCTCTTTCGGGAAAAACCGTTTTCCG
TATTGATTTCGGGGGGCGCTGCATGTGAGCTTCCCATAAACCAAATATGCATTCTAAAAC
GCCCGATGAAAGGAGTAGTTAGCTGCAGTTGGAACGAATGTNGTGGGGAGGGGAATCGAA
TGAAAAGAAGAAGAAAACAAGTTCTGGGCCGCACAGTGGGGCAAGCTTAGAACTGTAGTG
ACCACTGTGCGGCAGCAGTTGAGCTTCTAGTTTGCAGTAAACGCTTCGGTCTCTCTCTCT
NTCTCTTTCGCTCACGCANGAAACCCTGTTTTCGAGAAATCGTTTTTTATAGCTTTTGNC
ACTTGCCNCCAGANCAGGCCAAANTAAAAAAANAATTNACCCAAAGAGTATTTCCACANG
TTTTGGNCNGCTCGCCTTTTTTTGCCTGTTGGNGNTGGNGGGGGNTGGTTGCTGCNCCTT
GCCTAGNTGNTTCCNCTNTCNGNNTATCANTATACCTGGNGGNNGGCCCCCCGNTNGGGG
GGTTTACCTNTTTNGNAAAATNTTNGTTNAAATAGNAAGGGGGNGANNANCCCGCCCNCC
AAAGGCCCCNANCACCNTTTTNCNCCCNTANNCNNCNNCACGGGGCNGGGGGAACGGGGG
CNAGNCACNCGGTATTCNNNAACCNCNNNCCCCAGAGGTTANGGNAACNNGNAANAAAAA
GAGGGNCCCTTCCCCCCCGCnaaanaccccttgnngnnnattttgannaaaangntnccn
ggggnnacnnantcaaaggcntntnaagggggtttnttantaaaaaaaacccnancttnt
tataaanaggncgcccgataaaaaggggngnntttttnaccgttccccaaaatattcnan
gnnggggangggnaatttanatagtgataaccatnangaggncccctnccnccttttttg
ntn


CLOSE