Detailed Information [103989]

Strain Information
DGRC Number 103989
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}Hel89B[NP1326] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}Hel89BNP1326 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 89A11
Map Viewer
Related Genes mor Hel89B
Original Number 1326
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP1326

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1506
General Information NP_lines
Embryonic Expression AS, lymph? (SG)
Larval GFP fb
Larval X-gal fb, epi
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np20285_0807
Strand Plus
Insertion Point 11799417
Chromosome Band 3R
Flanking Sequence
aatntttttggngtgacactgcnatttntttgtatacttcggtaagcttcggctatcgac
gggaccaccttatgttatttcatcatgGCATGAGTTGAATTGTGAGTGGGCGCCCCACAT
AAGCTGACTGCTACCGCACAACGAAGGGAACTAGAAAGAGGAGTGCGTAGTGCGGAGAGA
AGAGCAAAGGCGAAGCGAAGAGGAAGAGAGCGAGAGAGAGCAACCATTGCCAAAGGTAAG
TGATATAACACTCGGAgatcgaagaatacataagagagaaccgtcgccaaagaacccatt
attgttggggtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagacca
atcaaatccatgaagagcatccctgggcataaaatccaacggaattgtggagttatcatg
atgagctgccgagtcaatcgatacagtcaactgtctttgacctttgttactactctcttc
cgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccac
tngntnnnnnnnnnnnnngggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE