Detailed Information [103995]

Strain Information
DGRC Number 103995
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}CG17273[NP1336] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}CG17273NP1336 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 93A1
Map Viewer
Related Genes CG17272 BcDNA:LD32788 CG31223
Original Number 1336
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP1336

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1566
General Information NP_lines
Embryonic Expression sg, pns (ch subset)
Larval GFP no larva
Larval X-gal sg, gut, mt, fb, epi
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np20375_0807
Strand Minus
Insertion Point 16654421
Chromosome Band 3R
Flanking Sequence
atttttgngtgcactgnatttatntgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgACCCGGACTATAAGCTATGTGCATACATACATACACATG
TATGTATGTATAAGCCCTCTCCTTGGCACCGCGTAAACATTTTGATTATCTTGTTTTTGG
TTTTTAGCAATAATTTGTGAAGGTTCCAGAATTTTCACTCTTCTGCTGCCGCTAATCACC
CATTTCGTATTCTCCTGACGGTCGGTCTCTTCATATAGAAAACAAATTCGTTAGATTAGC
GAAATGTAGGCATTTTCTGTACAGTTGCCAAAATGAAATGAAACGGAAAAACACATTAAA
TTTCTCGAGTGCTTACGTGAAATGGTCGTAGTCATCTGTATGTGTGAAAACGATTTGCAT
TTATTGTCATTTGATATTTGTGGGCACGTGGGACAAATACGTACTTATGTACATATGTAT
GTAGATACCCCTTTCGATGGGCTCTGTGTGTTTCAATTCGCAAGATATGCCTATAATATT
TATTTATTTTTCCCACAAGCTTTTGTTTTTCTTCTCGCTCGTCGCACAAACGAAAGCCAA
ACAAATATTGGCTAATTTTGTATATCAACANGCATACTTTGTATATCTGGGNAACTACAT
TTTTCAATCTTTTCNATNCACAGGGCGGNAACNACGCTGGACACACTGGGGNGGGCTAAT
GGNACNGGAGTTCGACNTTCCATNTTCTGGCCAGGGGGGGNTGGGAACCNANAAANGCCG
TTTNCCGTCATTNGGNAANTtggggatgctggaattggggtntnttttggnccnttgggc
cngggttcnaaaaaaaccataaananannaacccgccnccnaaaaaacccatttttggtn
ggggnncccnttttcaggaaagggcaaagcccttcccnaatnttttttcctttttagnac
caatnaaaatnccttggaaaggccttccctggggcntnaaaaancacng


CLOSE