Detailed Information [103999]

Strain Information
DGRC Number 103999
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}Sug[NP1341] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}SugNP1341 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 68D2
Map Viewer
Related Genes TfIIEalpha CG14133 CG7334
Original Number 1341
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP1341

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1870
General Information NP_lines
Embryonic Expression mt?
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np20415_0807
Strand Plus
Insertion Point 11641667
Chromosome Band 3L
Flanking Sequence
nntttttgttcttcggtagcttcggcttcgacgggaccccttatgttatttcatcatgGG
TGTGCCGCAGATAAGGCGGATTCGTAAACAAACGACGGCAAACACAACCAAACATGTTGA
CACTCGGCTCGTAACGCCAGCGGCTCCATTCAGTCGTGTTTTGGATGTCCATCTAGCCGG
AGGCCTCGATTTCCGCGGACTGTGCGTGGTGCGGCACTCAATTCGTGCTAAAAGTGCGAC
AAGTTCCCTTGCACTTCGAATAGCCAACGAGCAAAAGTGTTGATTCTTTGAAAGGGAAAC
NGGTTAAACCCACTCAGCGGATTTCAATTGGAGCAGAAACGTgatcgaagaatacataag
agagaancgnngcccaanaaaccattnttggtnggggnccgtttttangaaaggnaagcc
cttccgcatgttattctntttanancaataaaattcctgaagaggccttcctgggcataa
aancacgggattggggggtttttttggggngggggcgggnaaaanaaacagnaananngt
ttgaccctttggaccaccccntttcccanaagaggggccccttttttttttgggggncaa
aggngnnggngattannttccccgagctcnnntttnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnn


CLOSE