Detailed Information [104015]
 

Strain Information
DGRC Number 104015
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP1510 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP1510 / FM7c
Break points/Insertion Site 9D3
Map Viewer
Related Genes spri H-element{}99
Original Number 1510
Chromosome 1
Comments NP line. Received from the National Institute of Genetics.
Balancer FM7c
Cluster id 262
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression AS, cns, pns (ch subset)
Larval GFP cns
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np19495_0807
Flanking Sequence
atntctttngngtgacactgnnnttaantgtatacttcggtaagccttcggctatcgacg
ggcaccaccttatgttatttcatcatgCTCTAGTNNNTANAGNGNANCTGCAGNNNTGAN
NNCNTNCCNTTGTCANTGNACNANGCTTANANAGGCAAAAACAAACTNTGANCTNGNNGC
NGTCNNTGCACNTACNCTNATGNTAACCTACANANGATGNTNATAGNGTGTANCTAATGC
GTGCACCCANCAGTNCANGNNCCNTTGAACTTGCATAAANTNATTNNGANGCNCCNNACA
CNGNCANGCCANCNNAGCTTCAGGACGCGCGGNNCTTTNTTNGCGGCCTNTNCNGTTNTT
CNTGCNTNTGCCTCNCTATTTTTGCGCCNGGTCCCTNGACCGANGAAGGGTAACGNGCAT
GGTNGGAANGCCTGATTGCAATGCGGATNGNAANAGTNCATAAGAGAGAACCGGCGGNCA
ANGAACCCAANNATAGTGGGGGTGCCGNCTTTAGGANNGNNAAGCCNTCCGNGATGTNAT
NCANTNACTACCANGCAGATNCANGAAGAGNANCCNTGGGCGTAAAACCCACNAANNNNN
NNGGGGNNNNNNGGGNNGNGCNTNCCGNNTNNNNNAANNCAANNNAAGNGNNNNNGACCN
TNGNTACNAACCNNNTTNCNATGNAGATNNNNGNNCNTNNTTNTATGCTGGCNNAGNGNN
ANAGGCANATNAAANCTCANTGAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNAAANCNnnnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnggnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnaannnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np58753_0309
Strand Plus
Insertion Point 10287008
Chromosome Band X
Flanking Sequence
ttttactgcgcacttattgcaagcatacgttaagtggatgtctcttgccgacgggaccac
cttatgttatttcatcatgCACTAGAGAGGCGATCCTCGGCCNNGGCGCNTAGGCCNNTA
NAGGATNATGNATAGCTATAGCTAGNGCTTTGCTGTGCAGAGNAATGTANTTTNATGNCC
AATTACACACGANGNCTTATGNTNNNANTNANNCNCACGCACACGAATNCAAAGGNCNNT
GNTAAGNTGCGCAAATCGCAAATGTTTTGTTTTTCTTTTCGCTCTCTCGCCCCTCATGCG
TTGTTTTGTTGTTGCCGCCGCGATCCTCTAGCTAGAGCTTNGGGCACTTGTNGATNTGAA
NCCTNTANCTTTAGCTATGNTTTCNTGNAANTAATANANGAGNNANTNNAAACCNCTTTG
NCNTGNTNANGNTTANNAANCNNTNNNNNCNNNNNNNNNCTNNNNNNNNNNNNTNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnntnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE