Detailed Information [104018]

Strain Information
DGRC Number 104018
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}RhoGAP18B[NP1514] / FM7c
Genotype y* w* P{w+mW.hs=GawB}RhoGAP18BNP1514 / FM7c
Break points/Insertion Site 18A3
Map Viewer
Related Genes RhoGAP18B CG7502 412{}165
Original Number 1514
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP1514

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 437
General Information NP_lines
Embryonic Expression mg, constriction between 1 & 2, good driver
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np51425_0227
Strand Plus
Insertion Point 18877648
Chromosome Band X
Flanking Sequence
gacttaagtgntacttcggtaagcttcggcttcgacgggaccaccttatgttatttcatc
atgGTTCCACCCATCGCTCACCGTTGTTTGTCTTCGCTTGAGATTCAATCTGCCTTCCAT
GTCTTATCGCTGTCTCTCTCTCTATTTCTCTCTCTCTCTCTCTCCCCTTTTAGACTGCAC
ACCCACAACAACTATGCGCTATCTCTTTTTCCGTGGACAGTGGAGCGGGCGGAAAGCGGA
ACGCACAAACACCGATACAGAAAGCAATTGCGATAAGAAATTGATTTCGACTTGTAAGAA
ATCGCGCAACGCCACGGAAAATAAATGCAAGCGTCCAAGATAACGGCTAATCGAACAGTG
CCGCTCCAAGGNGCCGNTGCCAATGCATTTATCGNCTTTGCCACGCCCAACCGGNGNGGC
CGACCGATCCGAGAATACATGAGAGAGAACCGGNNNCCAAAAACCCATTTGTTGGNGGGG
GNCCGTTTTCAGGGAGGGCNAAGGCNTNCCAANTTTTNTNCCNCCTNAGAACAANNAANT
CANGGAGGGGCTTNCCTGGGCCATAATNCCACGGGANTGGGGNGGTNNNAANGNGGGGCC
NCNNNNNNANTNNNNCNGGCNANGGGNTTTNNCCTTGGGNCCCCCCNNNTCCNAGGAGNN
GGNCCNCTNNTTTTTTTGNGGNAAAGGGTNGGGGGNNNNNAANCNCCCCNGNGCANNNNN
TTNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnn


CLOSE