Detailed Information [104030]
Strain Information
DGRC Number 104030
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}msl-1[NP1565] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
w*; P{w+mW.hs=GawB}msl-1NP1565 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 37A1
Map Viewer
Related Genes CG10336 msl-1 tos
Original Number 1565
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1565

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1235
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression pns subset?
Larval X-gal sg
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np19825_0807
Strand Minus
Insertion Point 18666634
Chromosome Band 2L
Flanking Sequence
attnttnggtgcactgacttttttgtatacttcggtaagcttcggctatcgacgggacca
ccttatgttatttcatcatgGTACGGCGTATCAGCTGAAGAGATTGTGTGCACCCCAAGC
GACGCAAACAAAACCAAAACAAAACAAAAACATTTTGGGAGAATTATGAGATCGAAGAAT
ACATANGAGAGAACNCGTCGCCAAAGAACCCATTATTGGTGGGGGNCCNTTTCAGGGANG
GNNAGCCCTTCCGCCTTGTNATCCTTCTTTANGANCCANTAAANTNCNTTGAAAGANGCA
TCCCCTGGGACNATTAAANTNCCANCGGGNANTTGTGGNAGTATTCATGGATGAAGCTGG
CCGAGGTAANTCGATTCCAGTANAACTTGTCTTTGGNCCTTGGTNNCNACTCTCTTCCGA
TGATGATGGNCCCACTTTTTTCTATGCTGTCTCAATGTTAGAGGCATATCAGTCTCCACT
GAAGCCATCTTNTTTTGNGGNNNTNCCTNGGNNCTNAAAAANCNANNGGNANTNNNGNNN
TTTTNNGGANNNGNTGCCNNGCNANTNNNTCCNNNNANNTGGNCTTNGNNCNTTGGNNNC
NNCNNTTNTNCCNANNANNANGNNNNNNTNNTTTTNTGNNNGNNTAAAGGTNNGNGGNNN
NTNNNNNNTCCCCTGAGCCATNNNTNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np51165_0227
Strand Minus
Insertion Point 18666634
Chromosome Band 2L
Flanking Sequence
gggnnngnntngttngttttttggnnngganaacttggngncaaanaccctantttttac
ttncggtaagactccggctatcgacgggnaccaccttatgttatttcatcatgGTACGGC
GTATCAGCTGAAGAGATTGTGTGCACCCCAAGCGACGCAAACAAAACCAAAACAAAACAA
AAACATTTGGAGAATTATGAgatcgaagaatacataagagagaaccgtcgccaaagaacc
cattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcctcttcag
accaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgtggagttat
catgatgagctgccgagtcaatcgatacagtcaactgtctttgacctttgttactactct
cttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcatatcagtct
ccactgaagccatctnnntntggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnn

CLOSE