Detailed Information [104046]
 

Strain Information
DGRC Number 104046
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Gyc76C[NP1608] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype w*; P{w+mW.hs=GawB}Gyc76CNP1608 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 76C4; -; 76C5
Map Viewer
Related Genes CG32215 HLH106
Original Number 1608
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP1608

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1989
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression sg
Larval GFP fb
Larval X-gal sg
Adult GFP abdomen
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np19885_0807
Strand Plus
Insertion Point 19710414
Chromosome Band 3L
Flanking Sequence
ttttttttgcactgantttangtgtatacttcggtaagcttcggctatcgacgggaccac
cttatgttatttcatcatgCTCAAATGCTGTCGCAGTGCTAGTGCTCTGTCTCGCTTCGG
CTCTCTCCATCTTCTTTGCCCGCTATCACCGCTTGATAAGAAATGCGTTAATCTTTATTA
AGCGCTGCCGCTGCTAGTGTGTGCGTGTGTATTGGTGTGTATTCCGCTGAGCTCGTGCGT
GTGTGCGTTTGCGGAGTATTTACATGGGAGTTTTTCATTTTCTGCTGACAATTTCCGTTG
GAAACTTTTCGCCAAGGAGGTGCTAACACTAGCAAAACTGGCAAAGTCCAAACGGAAAAT
GTAATTTATGCAGAAAGCCGGAGAAACAGAAGCACAGAGAGTATGAGAACAGCCAGAAGA
AGAAATAGAAAAATCGGACCAAATCTACAACAACAGCTTGTTGGATGACTCAATATTGCA
GTGAAATAAAGGCTCTTTTGTATCAAGGAAAATAGGAAAATGATTAATACAGGAATATTT
CCAAGTTGCAAGACAGTTGGGAAATAACAGAGTCATAATCACAGCGTTCNGGAAATATAT
TTAGTTTNACATTANGGTAAACTAATTTTAGNTATTTTATATTTAGTTAACATTAGGTTA
ACTAATTTATTGAATAAAAAAGGCTGGATATTNGATTTGNAGCATTTCCATTNTTACCGG
AATAANAAAATATGCTGCATATACATCCATCGGATTATAAGATTTGATAGCTAGGGGGAG
TNAAANTNAAAAAGGATTTAgnnggggaanagnccnntnanaacctttnctgagacccgn
ggttgaagttttcagttaattnaaaannggccttggaataaaaanccccnnctta

CLOSE