Detailed Information [104051]

Strain Information
DGRC Number 104051
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP1616 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP1616 / FM7c
Break points/Insertion Site 18D11
Map Viewer
Related Genes CG12238 CG14213
Original Number 1616
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP1616

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 457
General Information NP_lines
Embryonic Expression sg
Larval GFP sg
Larval X-gal sg
Adult GFP abdomen
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np20505_0807
Strand Plus
Insertion Point 19369714
Chromosome Band X
Flanking Sequence
tttnnacgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggacca
ccttatgttatttcatcatgATTCAGACTTTGTGTTTTCGTACGGCGGGAAGTTTCTCTG
AAAATTTAAATTTATGTACATATTTACATCGACGCTGGAAAACAAATAGCGCGCTTGCGT
TTCACCAATTTCCAGCGGCATTTGCGCGGTTCTGGCCACACTGTTCGGCACACAACATAA
TCCTGGTTGTCGCCACTTGTTTTCgatcgaagaatacataagagagaaccgtcgccaaag
aacccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcctct
tcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgtggag
ttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgacctttgttacta
ctctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcatatca
gtctccactggctnnnnnnnnnnngggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnn


CLOSE