Detailed Information [104061]
Strain Information
DGRC Number 104061
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Uba1[NP2006] / CyO
w*; P{w+mW.hs=GawB}Uba1NP2006 / CyO
Break points/Insertion Site 46A3
Map Viewer
Related Genes Uba1 Mmp2 CG30002
Original Number 2006
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP2006

NP line. Received from the National Institute of Genetics.

Original Comments comment1:A, comment2:46A1
Balancer CyO
Cluster id 637
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression cns + pns subset
Larval GFP sg
Larval X-gal sg, weak epi
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np26555_0807
Strand Plus
Insertion Point 4753563
Chromosome Band 2R
Flanking Sequence
aangtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccacctt
atgttatttcatcatgGCCCCCACTCCGTCACCCAACAACTCTAAACGCCTTTTTTTGGC
CAGCGGCGAATGGTCACTTGAGCTGCAGGCTGGCGAATCGGCCATCAATTGCTGACCGCT
CGACATAGCTTCCTTGCTGAAATATTGGCAATCGAATTTCCCAGTTGCGGCTGCACCGCT
CGCCCTCTCTCTTTCGCACACACGCACACTGCAGAATGCGGACACACGCACACGGATGGA
CACACAAGAACGCTATTTAGTCCGGAAGTCAATTTCCCGTGGTTTCTGACTCGTTCCAGG
ACAGCGGATTCTATTTGTGGCCGAATTTCTAACAACGCACTCCCAAAAATACAGAACACG
CACgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtcc
gttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatga
agagcatccctgggcataaaatccaacggaattgnggagttatcatgatgagctgccgag
tcaatcgatacagtcaactgtctttgacctttgttactactctcttccgatgatgatgtc
gcacttattctatgctgtctcaatgttagaggcatatcagtctccactgagcatnnnnnn
tnnnngggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE