Detailed Information [104076]

Strain Information
DGRC Number 104076
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}SPoCk[NP2070] / TM3, Sb[1] Ser[1]
Genotype w*; P{w+mW.hs=GawB}SPoCkNP2070 / TM3, Sb1 Ser1
Break points/Insertion Site 80A1
Map Viewer
Related Genes l(3)04053 FB{}1097 Ivk{}1098
Original Number 2070
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP2070

NP line. Received from the National Institute of Genetics.

Balancer TM3 Sb Ser
Cluster id 2038
General Information NP_lines
Embryonic Expression scattered cells
Larval GFP sg
Larval X-gal sg
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np32535_0907
Strand Minus
Insertion Point 22667317
Chromosome Band 3L
Flanking Sequence
nnattnnntgttcttcggtagcttcggcttcgacgggaccccttatgttatttcatcatg
ATGTAGTCGTTCTCCTCCTTCCATTGTTGCTGCTgatcgaagaatacataagagagaacc
gtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagccatccgacat
gtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacgg
aattgnggagttatcatgatgagctgccgagtcaatcgatacagtcaactgnctttgacc
tttggtactactctcttncgatgatgatgncgcacttattctatgctgnctcaatggtag
angcatatcagtctncactgaagccatntttttttggggnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnatnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnag


CLOSE