Detailed Information [104084]
Strain Information
DGRC Number 104084
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Adf1[NP2090] / CyO
w*; P{w+mW.hs=GawB}Adf1NP2090 / CyO
Break points/Insertion Site 42C3
Map Viewer
Related Genes Adf1 Dpit47 S-element{}758
Original Number 2090
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP2090

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 537
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression epi
Larval GFP cns, others
Larval X-gal ventral wing pouch and hinge
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]

Library & Clone Information
Library Name / Clone Name np / np28125_0807
Strand Minus
Insertion Point 1723204
Chromosome Band 2R
Flanking Sequence
cttcttgggngcactgaccctaagtgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgGTACGTCCCAGCTCAGTCGCGTCTCTGCCAATTAGGGGT
GGGAAAACGCCGATGAAGGGGTCATCAGCGCATCGATAATTTTAAAACTCTCATACAATA
TCAATATGTTATGGCGACTATCGATGTTTCTGATTATCACCAACAGCTGCGTAAAGCGTC
ATAAGGCTTAAAGTTTTACCATGTTAAGATTTAAGATGTTAAgatcgaagaatacataag
agagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagcca
tccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaa
tccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgt
ctttgacctttgttactactctcttccgatgatgatgtcgcacttattctatgctgtctc
aatgttagaggcatatcagtctcctngntcnnnnnnnnnngggggggnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnn

Image Files
Disc

d1 (->Large)

d2 (->Large)

CLOSE