Detailed Information [104085]
Strain Information
DGRC Number 104085
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}CG13625[NP2092] / TM3, Sb[1] Ser[1]
w*; P{w+mW.hs=GawB}CG13625NP2092 / TM3, Sb1 Ser1
Break points/Insertion Site 96A9
Map Viewer
Related Genes CG13624 CG13625 CG9469
Original Number 2092
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP2092

NP line. Received from the National Institute of Genetics.

Balancer TM3 Sb Ser
Cluster id 1626
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression scattered cells
Larval GFP sg
Larval X-gal sg
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]

Library & Clone Information
Library Name / Clone Name np / np28135_0807
Strand Plus
Insertion Point 20401450
Chromosome Band 3R
Flanking Sequence
actntttngngtgcactgcctttaattgtatacttcggtaagcttcggctatcgacggga
ccaccttatgttatttcatcatgGCATGGACATTTTTGTGCAATAAAAGCGGGAAATTGT
AATTTACAATGAATTGTTTACGTTTTTTATGTGCTCAATGTTACCGTTCATAGTATGTGT
CGAAATGCCACGCACTGCTTGAGTGCTGTTAGGCTGCGCTTAACAGCACGCAGTTAACAA
TGTGCAGCAGTCTGGCAACGCCAGCGTGTATGCACTTGTCATTTAATTAATTATATAAAC
TAAGCTTGTTTTTCATTACATTCTTCAATATGATAGCATATATTATTATGTAGATTTGAT
TTCTTGCCATTTATTgatcgaagaatacataagagagaaccgtcgccaaagaacccatta
ttgttggggtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaa
tcaaatccatgaagagcatccctgggcataaaatccaacggaattgtggagttatcatga
tgagctgccgagtcaatcgatacagtcaactgtctttgaccctttgttactactctcttc
cgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccgc
tnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnn

CLOSE