Detailed Information [104094]

Strain Information
DGRC Number 104094
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP2114 / TM3, Sb[1] Ser[1]
Genotype w*; P{w+mW.hs=GawB}NP2114 / TM3, Sb1 Ser1
Break points/Insertion Site 87A3; 98D6
Map Viewer
Related Genes Noa36 Hsp70Ab Hsp70Aa CG3281 Hrb98DE S-element{}1293
Original Number 2114
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP2114

NP line. Received from the National Institute of Genetics.

Balancer TM3 Sb Ser
Cluster id 1451 1666
General Information NP_lines
Lethality lethal
Embryonic Expression scattered cells
Larval GFP sg
Larval X-gal sg
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np61573_0309
Strand Minus
Insertion Point 24414927
Chromosome Band 3R
Flanking Sequence
ttttctncgcacttattgcaagncatacgttaagtggatgtctcttgccgacgggaccac
cttatgttatttcatcatgANCTGAAAANATATNNTCCTGTGGAAAGGAAAGCCGTNGAC
AGACCTTACAAAAATACTACGCACCTAAATAAANGCAANGGTATTTGGTTACACTAATCG
GGNGTTGCTTCCACTTGTNTCCACTGNAANTNTATGNGGNNCAAATTANNGTNTATGGNA
NAACGGTGAANTATGGAAAATGAGAATCTNATTTATNNATTTAATNTTTNGCTATTTATA
GGTAAATTCCAAANAANATACATTCTGCAAAAAATCTNAATAGNTCGAACTNTTTAAGAG
ATCCNTTTNCTAGAGGNTTCGCNANCTAGNGCNTTGGGATCCTNTAGCTAGAGNTTNNNN
NNCTNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np28305_0807
Strand Plus
Insertion Point 7784136
Chromosome Band 3R
Flanking Sequence
GGNANGCTTCGGCTNTCGACGGGACCNCCTTATGTNTTTATNGTGGGCACACTATTCTCG
TTGCTTCGAGAGAGCGCGCCTCGAATGTTCGCGAAAAGAGCGCCGGAGTATAAATAGAGG
CGCTTCGTCGACGGAGCGTCAATTCAATTCAAACAAGCAAAGTGAACACATCGCGAAGCG
TAAGCTGAGCAAACAAACAAGCGGCAGCTGAACAAGCTAAACAATCTGCAATAAAGTGCA
AGTTAAAGTGAATCAATTAAAAGTAACCAACAACCAAGTAATTAAACTAAAAACTGCAAC
TACTGAAATCAACCAAGAAGTCATTATTGAAGACAAGAAGAGAACTCTGAATAGGTCGAT
AGCGTCAATGTCCGCCTTCAGTTGCACTTTGTCAGCGGTTTCGTGACGAAGCTCCAAGCG
GTTTACGCCATCAATTAAACACAAAGTGCTGTGCCAAAACTCCTCTCGCTTCTTATTTTT
GTTTGTTTTTTGAGTGATTGGGGTGGTGATTGGTTTTGGGTGGGTNAGCANGGGGAAAAG
NGNNNAAAAATNCCNGNNNTNGGNCCNNNNNGGTTNNNNNNTNCNTNNNNNNNACCCNNN
NCNAANAANCCNTTTTTGNTGGGGTCCNTTTTNANGAAGGGNNNNNCNTTCCNNNTNNNN
NCTTTTTNNNCCNNNNNNNNNNNNNANNNNNNTCCNNGGNNNTTAAANCCACNNNNNTNN
NGNNNTTNTNNTNNNNNNNNTNNCNNNNNNNNNNNNNCNNNNANNNNNNNTNNNCCTTNN
NNCCNCTNTTTNCNNNNNNNnnnnnnnnnttttntttnnnnnnnnnnnnnnnnnnnnnnn
nnnntncnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnna


CLOSE