Detailed Information [104116]
 

Strain Information
DGRC Number 104116
Genotype with FlyBase Link P{w[+mW.hs]=GawB}CG3835[NP2179] w[*] / FM7c
Genotype P{w+mW.hs=GawB}CG3835NP2179 w* / FM7c
Break points/Insertion Site 2D4
Map Viewer
Related Genes ph-p EG:87B1.3
Original Number 2179
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP2179

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 61
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression sg
Larval GFP fb
Larval X-gal epi, fb, mt, gut
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np27705_0807
Strand Plus
Insertion Point 1898457
Chromosome Band X
Flanking Sequence
atttttcgtgcctgaatttaattgtatacttcggtaagcttcggctatcgacgggaccac
cttatgttatttcatcatgATTGAGAGATTCTGGCGCGTGAGGCTCTCCCATTCCCGGTT
ACTTGTCGTGTGTTAGTGAATGAGgatcgaagaatacataagagagaaccgtcgccaaag
aacccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcctct
tcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgtggag
ttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgacctttgttacta
ctctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcatatca
gtctccactgagctctttttttttgggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)

CLOSE