Detailed Information [104162]
Strain Information
DGRC Number 104162
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP2343 / TM3, Sb[1] Ser[1]
w*; P{w+mW.hs=GawB}NP2343 / TM3, Sb1 Ser1
Break points/Insertion Site 84D14
Map Viewer
Related Genes CG10919 pyd3
Original Number 2343
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP2343

NP line. Received from the National Institute of Genetics.

Balancer TM3 Sb Ser
Cluster id 1373
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression a small # of cells
Larval GFP mt
Larval X-gal sg, mt
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]

Library & Clone Information
Library Name / Clone Name np / np21045_0807
Strand Minus
Insertion Point 3575824
Chromosome Band 3R
Flanking Sequence
attttngcgtgcactgcaatttatntgtatacttcggtaagcttcggctatcgacgggac
caccttatgttatttcatcatgGTCAGCAGACTCATTTCATATACTGCGGTGGTCGGAGA
AGGTTGTTCTATCAATTGAGTCGATAATTGATGAGATATTTTGTTGCTGTAAAATTGGAA
AAATGTCAGCATTTGAACTGAAAAATTTAAATGATTGCTTGGAAAAGCATTTACCACCCG
ATGAACTAAAGGAGGTTAAGAGAATTTTGTACGGCGTAGAAGAAGAGTGAGTACAGTTAA
AAGACCATTAAAATCAAGTAAGAACATCATGTGGGGGTGGGTGCCTATAAAACCTCCAGA
TTATTCTAAAAATGTTTTAATCTTAATCTTTTCGCAAACAGAAGGGGAGCATACAAAAGC
ATTTCATTGTTACCTTAAGTTGCCCGTAATGCTTATTTACTACGAGTGGGTTACATTTGT
ATTACATTGCAATAAAGAACTTGCTTTGACAGAGCTACGTTTGCATCTACACATTAACAT
ATATACCCTTGAGAACATCTGGTGATGAAAGTGAAACGATCGAAGAATACATAAGAGAGG
AACCCGNCGCCAAAGAACCCATTATTGGTGGGGGNCCGNTTTCAGGAAGGGGCAAGCCAT
TCCGACATGTCATTCTTTTTCAGACCCAATCAAATNCATGAAGAGCATCCCTGGGGCATA
AAATCCACGGNAATGGGGGAGNTATCATGATGAGCTGGCCGAGTCAATCGATACAGTCAA
CTGTCTTTGACCTTTGTTACtactctcttccgatgatgatgncgcacttattctatgctg
tntcatgtagagcantagccncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE