Detailed Information [104181]

Strain Information
DGRC Number 104181
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}trx[NP2381] / TM3, Sb[1] Ser[1]
Genotype w*; P{w+mW.hs=GawB}trxNP2381 / TM3, Sb1 Ser1
Break points/Insertion Site 88B1
Map Viewer
Related Genes CG12207 CG14841 trx
Original Number 2381
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP2381

NP line. Received from the National Institute of Genetics.

Balancer TM3 Sb Ser
Cluster id 1481
General Information NP_lines
Embryonic Expression a small # of cells
Larval GFP sg
Larval X-gal central pouch
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np21345_0807
Flanking Sequence
TTTTTGGGGTGNCACTTGGNATTTTAATTGTTATTACTTTCGGGTTAAGGCTTTCGGGCT
TTTCGGACGGGGACCCCCCTTTATGGTTTATTTTCATTCATGGAGGCGGGAACAAAANGG
CCAGGCTGGCAATTTGGCNACCTTTTCCTTTGGCTTCANGGANGCCAGGGGAAAGGANGC
GGGGCCCAGGGTGGGCAAGGANGANGTCCNTACCCCGANGANGTGGTGCCACCTCAAAAA
AACNNGGCTTTTCCNTTANGTTNAAAGGGAACCCCGANTACCATTTTTTTNANTAANTNC
CNGGAAAACCNGTNANTAANTTANTTTTTTTGGAANTNTNTTNANTTNNACCGANAANTC
CTTAGAAANNACCCGNNNCCAANGANCCNTTTTTGGTGGGGGNCCGTTTTANGGANGGNN
AGNCCTTCCANCTTNTATTCNTTTTAAANCCANTNAANTCCTNGANGNNCTTCCTNGGCN
TTAAANTCCANNGGATTGGNGNNGTATTNNNNANNNNNNGCCNNNTNATNCNNTCCAGNN
ANCNGNNTTGNNCNTTGGTANCTNCTCTNTTCNGANGANNANGTCGCACTTATTNTNTGC
TGTCTNAATGTAGAGGCATATCAGTCTCACTNGNTNNNNNNNNNNGNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnn

Library Name / Clone Name np / np59393_0309
Strand Plus
Insertion Point 10103992
Chromosome Band 3R
Flanking Sequence
tttttcgggcgnacttatccgcaagtttacgttaagtggatgtctcttgccgacgggacc
accttatgttatttcatcatgGTTCCGCTCCTTCTGCCGCTGTCGCACTTCTTGCGTGAC
CACTAATACACTCACACCTAAAACAGTGTTGGCAGAATTGGTGTTTTATTTAAATTAATG
GGATTTGATATTTAATATTATACTATTATAAAATTATAACAATACCTGTCAGTATCAAAG
TAATGACTGCTAAGATCCNCNGNCNGNCGCNTAGGCCACTAGTGGATCTGGATCCTCTAG
CTAGAGCCTTTGAGTNCTCGTAAATTATTAAANATNAAANTTTAAAAATAATTTNNNNTN
ATTAATATTATNANNNANTNNANNNTTANNGTCANNNTNANNNTTTTTANATTTATNNNN
NNANTTNTNNTTTTTNNNTAATNNNTNTNTTCTNTNNNTNCNNTNTNTTGNNNNNTTCCT
TTTNNNATTTGNNNNNNTNTNNNNNNNNTNNNTNTTANNNNAGANAGANNANTNNNNNTN
NTTTANNGTNNNNNGANNAAAANGNGNTTTNNNGNNNTNNGANNATTTTTCNTCATTTNN
TTTNCNAGNNTANAGNTNNCTTNANCCNNTTNNNNANAAGNTNGTTAGNGNNNNNTTGNT
NCTTGNNNAAAATGAGNGTTTNGGAGNGANNCGTAGCCATNNATTNTGGGNGGCNACNNT
TTNGNACGCNNNNNNNTTNTATCNNNTNGCCTNNCNTANNTNNATTATTTTTGNTCNCAA
NNATTNTTTTNNNTTNACNTntnntngngacnttnttttgtatttccnnnganngtnnnn
nangngcnntcgntcgntntntatttttttncnaancattannnatntnnnacccgtttn
tntatcgccngcgtttttttnnnnnnnttcttgcacanccnncggcgcagntttncncnc
ancatccccgaagnacangatnttattnnntnnttggtnggtntntcacncttttttaat
agnngncntcgatnttatntngntnntcngcacgnttttccncgccntncttntctgngn
tttcttntgtnnanatttttnnnnnnnaatgtnncnnancnactccnccnnc

Image Files
Disc

d1 (->Large)

d2 (->Large)


CLOSE