Strain Information | |
---|---|
DGRC Number | 104198 |
Genotype with FlyBase Link | w[*] P{w[+mW.hs]=GawB}Sxl[NP2426] / FM7c |
Genotype | w* P{w+mW.hs=GawB}SxlNP2426 / FM7c |
Break points/Insertion Site | 6F5 |
Map Viewer | |
Related Genes | CG33070 CG4615 |
Original Number | 2426 |
Chromosome | 1 |
Comments | FlyBase Insertion: P{GawB}NP2426 NP line. Received from the National Institute of Genetics. |
Also known as | LN2-GAL4 |
Balancer | FM7c |
Cluster id | 197 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | epi stripe |
Larval GFP | weak |
Larval X-gal | sg |
Adult GFP | abdomen |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-05-21 |
Research papers using this strain [Please submit your publication] |
Rozenfeld E, Lerner H, Parnas M. Muscarinic Modulation of Antennal Lobe GABAergic Local Neurons Shapes Odor Coding and Behavior. Cell Rep (2019) 29(10) 3253-3265.e4 [PubMed ID = 31801087] [RRC reference] Brown EB, Rayens E, Rollmann SM. The Gene CG6767 Affects Olfactory Behavior in Drosophila melanogaster. Behav Genet (2019) 49(3) 317-326 [PubMed ID = 30710192] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np21655_0807 |
Strand | Minus |
Insertion Point | 6836504 |
Chromosome Band | X |
Flanking Sequence | attttgggnaaaaacccttttttgtatacttcggtaagcttcggctatcgacgggacccc ttatgttatttcatcatgGGTGAGGAGAGGGCAGCTGCATTTATTTCCTTTTCTCTTCAT CTCCGCTTCTCGGTGGGTCATTCCCCTTCTTGCTGTTGGCAATGACGTCGCATCGCAACg atcgaagaatacataagagagaaccgtcgccaaagaanncattattgttggggtccgttt tcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagag catccctgggcataaaatccaacggaattgnggagttatcatgatgagctgccgagtcaa tcgatacagncaactggctttgacctttggtactactctctttcgangatgangncgcac ttattctatgctggctcaatggtagaggcatatcagtctccactgaagcatnttnttttt ggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnn |