Detailed Information [104248]

Strain Information
DGRC Number 104248
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}CG14434[NP2582] / FM7c
Genotype y* w* P{w+mW.hs=GawB}CG14434NP2582 / FM7c
Break points/Insertion Site 6D7
Map Viewer
Related Genes CG14434 CG32737 CG4558
Original Number 2582
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP2582

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 189
General Information NP_lines
Embryonic Expression a small # of cells
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np23195_0807
Flanking Sequence
cattttttgngtcttcggtagcttcggctatcgacgggaccccttatgttatttcatcat
gCTCCGGCGGATCGANGAATACATAGAGAGTAGAACGCGCNGNNAAANAACCNNTTATTG
GNGGGGTCCGATTTCANGAAGGGCAAGCCATCCGACATGTCATCCTCTTCAGACCAATCA
AATCCATGANGAGCATCCCTGGTNTTAATATCCAACGGAATTGCGGAGTNATNATGACGA
GCTGCCGAGTCAATCGATNCAGCCAACNGTCTTTGACCTTTGTTACTACTCTCTNGCGAN
GATGATGTCNCACTTATNCTATGCTGTCTCAATGTTAGAGGCATATCAGTCTCCACTGAA
GCCATCTTATTATGGNNNNCGGTATANTNNNTGGNCANGGGACGCCTNTTTTTTTTGNTT
GCNGNACAGACGCGNNTNNATCNNGNCNAGCTGAANGNNCTNNNNTNTNNNNTTCNNNCN
NNNNGGNNTNCCCNNNAGANNNTCNNNCNNTNNNNGNNGGNNANNNCANNNNCNNTANNC
TNNNNNNGNGANNNGNGNNNNNTNNNNNTGACCTNAAGNANTNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNGNNTNNNNNNNNNN
NNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnttnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnn
nnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnntnan

Library Name / Clone Name np / np60103_0309
Strand Plus
Insertion Point 6592962
Chromosome Band X
Flanking Sequence
cttttactgcgcacttattgcaagtcatacgttaagtggatgtctcttgccgacgggacc
accttatgttatttcatcatgCGCCGGAGTAACCGATTCGCACATGTTGTTTACGCTTTT
GTTTTTTGCAACGTATCGTCGATAGCCGATAATTGGCGCCACAAGATGCTTTNGATAACA
GAACATTACAATGCCCAATATAATGTTCTCACTGTCCAAATTCGGCCAAAAGGATAGTGT
ACTTAACTGCTATATGTTTAGTTCTTGTATTTTAATGAAGATGCAAGTTTGGGCTTTGCA
AATATTGAAATTATTTCTGTTTTGCTTGACACCCGCATCTACAGNATACTTCAGAAGAGC
AAAAGAAAAATGCAGCCAANTGTGAATGCTATAATATCGGTTTTAGTTNGGCGCCACTTT
TAAAAGNACCGGCTTTCGATCNTCCNNCNNCNGCATNGNNGACTAGTAGATNATGNATCN
TNTANCTANANCAGNTGNNNNCNCNNNNTNNTNATANNANNNNNTNNNNNNNNNNNNNNN
NNNNTNNNNNNNNNNNNNAANNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNN
NNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnn


CLOSE