Detailed Information [104283]
 

Strain Information
DGRC Number 104283
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP2673 / TM3, Sb[1] Ser[1]
Genotype w*; P{w+mW.hs=GawB}NP2673 / TM3, Sb1 Ser1
Break points/Insertion Site 67B4
Map Viewer
Related Genes aay Shc CG3967
Original Number 2673
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP2673

NP line. Received from the National Institute of Genetics.

Balancer TM3 Sb Ser
Cluster id 1841
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression pns subset (ch)
Larval GFP cns
Larval X-gal sg
Adult GFP proximal part of antenna, leg, haltere, wing (MT)
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np24055_0807
Strand Plus
Insertion Point 9384168
Chromosome Band 3L
Flanking Sequence
ATTTTAAANACTTCTTTGGGGAAAAAACCCNTTTTTGGGGCNNNNNNAAGCCCCGGNTTN
GNCGGGACCCCTTTTGTTATTTNATCATGGAGCCGGCGAAGCTTTGGCTTGCCACATAGA
GATGGCAAGCAGCTAACCGGTCAATCGATTGCTTAGGGATGGGAGTCTTCAAGAGTGCCA
GTTCCAATATTTTCAAGATATTGAAATTTGAGTAACGTAATCCAAGCAACTAGCACTTTC
AGTTACATTTTTATATCTTCTTTTGCATTATTGAAATGATAAGCTCGTTAGAACCCCCTT
TCAGCTCCACCACTGACCAACTATCGATATGCCTGCTAGCTGCGGTTACACTTCCAGCGC
TGCAGTGCGGCCACACTTTCGCGAATACGGTCCCACCTTGAGTAATATCCGAATTACTAA
TAACAAAGGCTTGCAGCCTACAGCTGCGGAAAAAGGACCAGCAAGAAGCCAAATCGCTGC
CAAGCGCCCACAGCCACCGCACAAATGCCTAAGAATGGCGATGCCGGCAACCGGAGCGGT
TCCGGGACAACCAGCGACGGCTGCATCTATCCGGACGACGTCATAATGGGCGTGGGTGTT
GCATTCAACGTGCGGTACACGGGATGCGTTGAGGTCAGACCTCAATGAAATCCCTGGACT
TCGAGACCCGTACGCAGTTGGCGCGGTAAGTGAGCAATAGCCATGAGTCACAGCAGTNTT
ATCATNNTTGGTTTGCCCTTGNCTGCAGAGAGGGCATNAATCGAGTTTGCGAGGCTGNCC
GTTTNAAGTCTGCTGGCAGGcggngattnaccaactttttnttnggttcgaaaaaaactt
naaaaagaaccgttcnccaaanaacccttttttggttgggggcccgtttttaggganggg
caagcccttcaanatnttattntttttcaaaccaataaatncntggaaaggcttccttgg
cct

Image Files
Disc

d1 (->Large)

CLOSE