Detailed Information [104298]
 

Strain Information
DGRC Number 104298
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}CG31635[NP2709] / CyO
Genotype w*; P{w+mW.hs=GawB}CG31635NP2709 / CyO
Break points/Insertion Site 26F3
Map Viewer
Related Genes CG11098 CG31634 CG31635
Original Number 2709
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP2709

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 1074
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression pns subset (ch)?
Larval GFP mg
Larval X-gal gut
Adult GFP internal, antenna(3rd seg.), ocelli, palpus, leg (MT)
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np24365_0807
Strand Minus
Insertion Point 6635739
Chromosome Band 2L
Flanking Sequence
gggaangatgtangtttttggnnngattacggggggnaaaaccccattttggngctncgg
aaagaccccggctatcgacgggaccaccttatgttatttcatcatgTTGAGACGCTTATC
TTCTTAAGAAACAAGAAAAAAACACCTTCGTCTGCTTTTCCCTTAGAATTTCTGGCCGAT
AATGACAAACGAGCGTCGGTCATGGCATTCAATTTGTCAATTCAAGTCAACGGCAGCGCT
TGATATCAATAATCAGATAAGAATGAGAGGCATNGNCAAAAAAAAAAAAAAAANNGGGGG
GGGGGGANTNNNANNCNANNNGGGTCCCNAANTNAAANGGGNNCNAAANNTTAANNNTTT
TTTTNNNANCCCNNNANNAAGGGGNGGGGGTNGNCNTTNNGNNCCTAAAANNAAAAAANG
GGNGGGNNAAAAAAGGTTTNNNNCNNGNTTTAAAANCCGGTNGGTTNNGNNGGTTTNNNA
AANAAAAAGGGGTTTTTCNAAAATTNGNAANCNGGNNGNNTNNNNTNANGGNNTTTNNNN
NTNNTGGGGANCCACCNGGNNGAAAACCAAANGGCGNNNNNAANTTTAAGGNNGNNGGGG
GGNAANNAAANTCCCCNCTTNGAAAAGNTTTCNCCCNAANTAACCCCCNTTTTATNGGGA
CATTTTTTCGGGTTTTTTGGAAAAAGCNCCCCCNCNTNCTANCNAAGGTTTTTTTTTTTG
GGACTTTGGCCCCCTTTCCNCTCCGGGGGGGAATTANGGGGAAANCCCCACCNNANAAAA
AAANGGGGGGGGGCCCNAAGggcnaaaaannggggggaaaaanaaaattggaangggttt
aaaaaaccccnnnnaannggggggccngnatttnanaaaaaaggggggggggggctcccc
ttttttanagggggnngnaaaaacaaaaaannaacccgccccccaaaaacccttttgggg
ggggcccntttnnnggnggggncccccccnagngtttnctttn

CLOSE