Detailed Information [104309]
 

Strain Information
DGRC Number 104309
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}pigs[NP2748] / FM7c
Genotype y* w* P{w+mW.hs=GawB}pigsNP2748 / FM7c
Break points/Insertion Site 6C1; -; 6C2
Map Viewer
Related Genes CG14443 CG3973 Burdock{}74
Original Number 2748
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP2748

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 181
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression cns
Larval GFP tr node
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Shin JE, DiAntonio A.
Highwire regulates guidance of sister axons in the Drosophila mushroom body.
J. Neurosci. (2011) 31(48) 17689-700 [PubMed ID = 22131429] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np24775_0807
Strand Plus
Insertion Point 6354963
Chromosome Band X
Flanking Sequence
TTAATTTGTTCTTCGGNAGCTTCGGCTTCGACGGGACCCCTTATGTTATTTATCATGGTT
ATGACCAGCTTATAAAAGAGTACTCAATAATGGCAAAGCGAATCTAATAGTTTACTGCTT
TCAATGTATTTAACGATATATGAAGCATATCGTACCAATTACGAATTTTTAATTGCGAAA
GCCTATAAACATATTAATTGATTGTAAACAACTTGAGCAACCGAAGTACATATAGGCAGC
CAATTTAACTGCCAGATTTTATTTTAATTTATGAGAAGCATTACCGTTCCTTGCTTCGTT
TTCTCGGATCGAAGAATACATAAGAGAGAACCGTCGCCAAAGAACCCATTATTGTTGGGG
TCCGTTTTCAGGAAGGGCAAGCCATCCGACATGTCATCCTCTTCAGACCAATCAAATCCA
TGAAGAGCATCCCCTGGGCATAAAATCCAACGGGATTGNGGAGTTATCATGATGAGCTGC
CGAGTCAATCGATACAGTCAACTGNCTTTGACCCTTGGTACTACTCTCTTCCGATGATGA
TGTCGCACTTATTCTATGCTGTCTCAATGGTAGAGGCATATCAGTCTCCACTGAGCTNNN
NTTTTNNGGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)

CLOSE