Detailed Information [104312]

Strain Information
DGRC Number 104312
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP2757 / TM3, Sb[1] Ser[1]
Genotype w*; P{w+mW.hs=GawB}NP2757 / TM3, Sb1 Ser1
Break points/Insertion Site 100C3
Map Viewer
Related Genes CG11576 ferrochelatase
Original Number 2757
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP2757

NP line. Received from the National Institute of Genetics.

Balancer TM3 Sb Ser
Cluster id 1706
General Information NP_lines
Embryonic Expression pns subset (SG)
Larval GFP sg
Larval X-gal tr
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np24845_0807
Strand Plus
Insertion Point 27625364
Chromosome Band 3R
Flanking Sequence
ttttcgtgcactgaatttaattgtatacttcggtaagcttcggctatcgacgggaccacc
ttatgttatttcatcatgGTTATGGGTTTGGAACTTATAAATTGTGTTCCTAGAAGAGTA
TATTAGTTAGCAAGCTCGCTTGGCATTCGCCATTTAAAAGCTACATTTTAGCATTCCATT
TTTATAGTTTCGCTGTAACATAGAAAAGGCATAGATGTTTTCTCAACAAAGCTACCACTT
CAAAACCAACTGTGCATTTTTTATACTGTTCAACAGAGACTTTAATTAAAGCGGAAAGAA
ATAAACACCAGTATGTGAAAACCAATCCCCCAGAAACCCAAATGAATGCATAAATGTTCT
CCTCCAGCTGCAGCACTTGAAACGCTTGTCACGCAGTGCTACCCACCCCCGCAAGTTGAC
TTGGTTGCTTAGTTCGAGCAGAGCTGGCGGTACCAGCTTTTGCTCTCCCTGCACTTTGGA
TTGGAGCACATGGGACAACGCATGAGGAACTTGGGGTTGACTGCCTGCTGGGACTTCAGG
TGGTCTGCCACAACGTTTGTCAGGGCGTCGATGAACAGCGGGTGGTCGTTGGGGGTTGCA
GCTCGACGGATTTNCTCTACGCCTACCTTCTTGGCCAGTTCGTCGCAGTACTCGATGTCG
AGCTCATGCAGCGTCTCGATGTGCTCGTTCACGAAGGCAATGGGCACAAGGATGAAGTTC
TTCAGGCCTTGCTTAACATAGCCCTGTAAAGATGGGATTGGTTTTAGTGGATNGGAAANG
GAATCCGGCATTAAAGTACNccttaatggcattatcagntgcgggcncagccanggtagc
gggcccnccttggattgcatgccaggctgtanggatttntttgaccanttcctgcattac
catgggtacnctagnaccaatntcnnnggntacccgtnaccccggttncaaccttaaggg
naagggggnggcnannaaaag


CLOSE