Detailed Information [104316]
 

Strain Information
DGRC Number 104316
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}shep[NP2762] / TM3, Sb[1] Ser[1]
Genotype w*; P{w+mW.hs=GawB}shepNP2762 / TM3, Sb1 Ser1
Break points/Insertion Site 64C12
Map Viewer
Related Genes CG32423 Quasimodo{}930
Original Number 2762
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP2762

NP line. Received from the National Institute of Genetics.

Balancer TM3 Sb Ser
Cluster id 1779
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression a small # of cells, AS
Larval GFP cns
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np24895_0807
Strand Minus
Insertion Point 5229986
Chromosome Band 3L
Flanking Sequence
tttttttggtgcactgactttanttgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgGTCCATGTATAATGTATAGATTGTTGAGATTTTACCGAC
ATAAATTACACAACTAGAAATTATACAGCTACCGCTTAAATAGAGACACTAACGGAAGAC
CTTATCTTGGGGAAAATAGCAAAAGTCTGAGTTGGGTAACCACCAACCCCTGGAAACCAC
CATAACCACCCACCAGCGAAACCACAGAGCCACTTCAAGACCCCCTTTTCCGCCCGCTGC
CATTAGCAGCGTCAGCTGTTTGTCCACTTAAAGAATGCCCAGATAATCGAGGCAACAAAT
GTGCCTAATGTCAATGACAATAAAGACAAATTATACAAATATTTGACTAACTGACTTTGC
TCACTCACTGACTGCCTGCCTAACTGACTGACTGACTGACTGACGAACTGGAATGATAAT
GACACCCATTGTTCGTGTGTAGAACAAGGAAAATTTCATTAAAAATCCCCACAAGCAAAT
GGACAAACCATTGGCCTCAAGAGGGTAGCAAAGTGGAAAACTGCCTTGGCCAGCACATTT
TCAATAATTACAACGAAAATCAAGCCCAATGACCGCAAATAAATCTGAAATAATAATGAT
TATTAGCCTGTGTGTTTGTTTGGTCAGATGGATGTATGGGGGCTTTTNCGAGGGCTGTTC
GAGCATTCATAAAGCCACAAAAATGTTTTTAATTACCAATAACCATGGAGAGAGGGGAAG
AAGGTCCAAANGGAAAGCACcgattagntcagcagcngggaaaaaatgcaactgnaaaan
ctttccatattattcattcattttcattggggggtggaaggggcgagggcttntccttat
tgtccattggccaaagngaaaaagggnnnccccttataattncnattaatttt

CLOSE