Detailed Information [104336]

Strain Information
DGRC Number 104336
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}CG3371[NP3004]
Genotype w*; P{w+mW.hs=GawB}CG3371NP3004
Break points/Insertion Site 61C8
Map Viewer
Related Genes CG3344 CG3371 CG3386
Original Number 3004
Chromosome 3
Comments Flies have Tb and Sb. 08Mar2017 E.O.
FlyBase Insertion: P{GawB}NP3004

NP line. Received from the National Institute of Genetics.

Cluster id 1730
General Information NP_lines
Embryonic Expression cns + pns
Larval GFP sg
Larval X-gal cns, epi
Adult GFP antenna, internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np33545_0907
Strand Minus
Insertion Point 665956
Chromosome Band 3L
Flanking Sequence
ACNCTNTGGGGAAANAACCCCCTTTTTTGGGGNCNNAAAAANCCTTCGGCTTCGACGGGA
CCCCTTTTGTTATTTCATCATGGGGTGGNCGAAATTGAGTGGGCGCAGCAGCAGCAACAA
AAACAAACAAGACGAAAACAAACGGCAATTGCCGTGTAAATTGCACGGAAAGCACAAACA
ATGCGGATACGCGAAAAACGCAAGTTGCAGAGGGAGNTTTTNNTGGAGAAGCGCGTGGAG
AGGGAGAAAAAGGAGCACAAGGAGGCCTCCAAGACGCAGGACAACAACAACAAGGCGAAG
GTAAGTGGCCACAGTCAAGCCTCGCAAAGTGTTTCCACCCCATTTCACTTCTCAAAGAAC
ACGAGTGTAAATGACTTGATCGAAGAATACATAAGAGAGAACCGTCGCCAAAGAACCCAT
TATTGTTGGGGTCCGTTTTCAGGAAGGGCAAGCCATCCGACATGTCATCCTCTTCAGACC
AATCAAATCCATGAAGAGCATCCCTGGGCATAAAATCCAACGGAATTGTGGAGTTATCAT
GATGAGCTGCCGAGTCAATCGATACAGTCAACTGTCTTTGACCTTTGGTACTACTCTCTT
CCGATGATGATGTCGCACTTATTTCTATGCTGTCTCAATGTTAGAGGCATATCAGTCTCC
ACTGAAGCCATNNTTTTTTTGGNNTNNNNNNCNNNNNNNNNCCCANTTNNGNNCTNNTTT
NNCCCCTNCCCNCTTTNTCGNACACCCNCCNNNNCTTTTCCGNTCNNCCNAAATNNGTTN
TNCTTNNNNCNNTNNNTTTNnnnnncnngnatgtnncctncccctttaccgaaaaggttg
gttgntntngnngnnnattcntnnnntnannnntnnnnattnannancnttnnnnncnnn
nntncctttntttttnttnnnnncnntttttnnnnnntgnnnncncncttncntttnttt
ntggttnnntntnncnnntncttnncnnttccctcccnnnnnaanat


CLOSE