Detailed Information [104339]

Strain Information
DGRC Number 104339
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Mmp2[NP3013]
Genotype w*; P{w+mW.hs=GawB}Mmp2NP3013
Break points/Insertion Site 46A1
Map Viewer
Related Genes Uba1 Mmp2 tRNA:M3:46A
Original Number 3013
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP3013

y[*] seems to be fixed. 07Feb2012 M.T.
NP line. Received from the National Institute of Genetics.

Cluster id 635
General Information NP_lines
Embryonic Expression weak
Larval GFP sg
Larval X-gal cns, epi
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np33615_0907
Flanking Sequence
GNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGNGGNNNGGGGNNNNNNNNNNNNNGG
NNNNNNNNGGGGGGGGGGGNNNNNNNNGGNNNNNNNNNNNGGNNNNNNNNNNNNNGGGGG
GGTTTTNTTTTTTTTTTTTTTTTAAAANGGGNNNNNNNNGGGGGTTNAANAAACCCTNGG
GGGGGGGNGANNGGGGNACNAAAAAAAACCCCCCANAATTTTTTTTTNNTTTGGGGGGGG
TAANAACCTTTTNNNNCGGGGNAAAAAANACCCTTTNNCGGGGNCCTTNATNNCGGGNAA
CGGGGGGNNANCCCCAACCCCTTTTTNAAGGTTTNNANTTTTNNCCANACCCANTGGGAA
ATNCCCGGNGGGGGGGGGNGAAAGGGGGGNAAAAAAAATTTTCCAAGGGNAAACCNCCNN
GGGGGGNAAAAAAANNNNNNNNAAAAAGGGGGNANNNNAAAAANGGGGGGGGGGGGGGNA
AAAAAAAAAAAANNNNGGGGAAAAAAANNNGGGGNTAAAAACCNGGGGNNNGGGGGCCCC
CGNAANCCCCCAAAGGGNGGGGGGGGGAAAAAGGGAAAATGGGGAAGGGCCCCAATNCNA
AAAGGGGGGGGGGGAAAAANTTTNNNNNNTTTTNCNNCNCGTTTTTNNCCCCCCGGGGGG
GGAANNANNTNTTTNNNNNNNGGGGGGGGGGGNNNNNNNNNNCNCCNGGGGGGGGNNNNN
NNNNNNNNNNNGGGGGNNNNNNNNNNNNNNNNNNNNNNNGGGGGGGGGGGGGGGGGNNNN
NNNNNCCCCCCCCCCCCCCNnnaaaaaaaaannnnngnnaaaancccnnttttggggggg
gggggggggggcaancncncaaaaantttttttnnnnnnnannannnnnnnnnnnggggg
ggggggnnnnnnnnnnnnaaaaaanaaggggggnnnnaaaaaaaaaaaaaaaaaaaaaaa
nnggggggggggggggccccccnannaaaaannnnnncnnggggggggggggggagnncc
ccccccccccccccccccccgggggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
gggnnnnnnnnnnnaaaaaaaaaaaaaaaaaannnnnnnngggggggggggnnaaaaaaa
aaaaaaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnngggggggggggggggggnnnnnnnnnnnnan
nnaannnnnnnnnnngnggggggggnnnnnnnnnnnnncccnnnnnnnnnnnnnnnnnnn
nnnnnngggggnnnnnnnnnnnnnnnncncccccccccccccccccn

Library Name / Clone Name np / np63103_0309
Strand Plus
Insertion Point 4737584
Chromosome Band 2R
Flanking Sequence
tttactgcgcacttattgnagcatacgttaagtggatgtctcttgccgacgggaccacct
tatgttatttcatcatgCCCCGAATGACATTAAAAATCAATCAATGGCACATTAAATTAA
TGAATACGACAACAACAATTGAGATCCNCGGNCNGNCGCNTAGGCCACTNGTGGATCATG
GATAACTNTAGCTAGAGNTTTGNNTACTNNNAANTAATTTTANNTGNAACTTTAAACANN
ATTGNCGACTAATTAANNTTATGAGTCAATNNAAACCCCACGNGCNTGTTAAGGGGGANT
CAACAACAATATCTCTGTGCTCNCTCACTCATCTTNGACACCNTNAAANTNCNNGGNNTT
TCTCTCGCTNTTTNGCNCNNNCATNCGATATGGTGNNTGTCNNGGCGCCGGGGNNCACCA
TTNTTGATGTTGTGATCATGCCCCCAGAGNTGNCATAANAACATNTTTTNGGGNCCCTTT
ATTTNTGATGTCGCNACNCCACNNTTGATATNCNNGCNCTGGNGNTTGGGNCTCTNGNGN
NTTNGNATATNACTTTNGANNNNNNNCNCNNNNNNTTTTTTNANGNGNNNNTNAANCCCN
NNNNNNNTTTANNTTTNNGNNNTNTANANNNNNNNNTNNTNNNNNNNNNNNNNNNANANN
NNNNNNNNNNNNNNNCNNNNNNCCNNNNNNNNTNNNNNNNNNNNNNNNNNNGNNNCNNNN
NNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE